ID: 912542235

View in Genome Browser
Species Human (GRCh38)
Location 1:110425802-110425824
Sequence ACCAGGATGGGGCTGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542235_912542251 27 Left 912542235 1:110425802-110425824 CCCAGGCTCAGCCCCATCCTGGT No data
Right 912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG No data
912542235_912542252 28 Left 912542235 1:110425802-110425824 CCCAGGCTCAGCCCCATCCTGGT No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542235_912542248 21 Left 912542235 1:110425802-110425824 CCCAGGCTCAGCCCCATCCTGGT No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542235_912542245 8 Left 912542235 1:110425802-110425824 CCCAGGCTCAGCCCCATCCTGGT No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542235 Original CRISPR ACCAGGATGGGGCTGAGCCT GGG (reversed) Intergenic
No off target data available for this crispr