ID: 912542237

View in Genome Browser
Species Human (GRCh38)
Location 1:110425813-110425835
Sequence CACAGGGGGACACCAGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542237_912542248 10 Left 912542237 1:110425813-110425835 CCCCATCCTGGTGTCCCCCTGTG No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542237_912542245 -3 Left 912542237 1:110425813-110425835 CCCCATCCTGGTGTCCCCCTGTG No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542237_912542251 16 Left 912542237 1:110425813-110425835 CCCCATCCTGGTGTCCCCCTGTG No data
Right 912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG No data
912542237_912542252 17 Left 912542237 1:110425813-110425835 CCCCATCCTGGTGTCCCCCTGTG No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542237 Original CRISPR CACAGGGGGACACCAGGATG GGG (reversed) Intergenic