ID: 912542238

View in Genome Browser
Species Human (GRCh38)
Location 1:110425814-110425836
Sequence ACACAGGGGGACACCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542238_912542245 -4 Left 912542238 1:110425814-110425836 CCCATCCTGGTGTCCCCCTGTGT No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542238_912542251 15 Left 912542238 1:110425814-110425836 CCCATCCTGGTGTCCCCCTGTGT No data
Right 912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG No data
912542238_912542252 16 Left 912542238 1:110425814-110425836 CCCATCCTGGTGTCCCCCTGTGT No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542238_912542248 9 Left 912542238 1:110425814-110425836 CCCATCCTGGTGTCCCCCTGTGT No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542238 Original CRISPR ACACAGGGGGACACCAGGAT GGG (reversed) Intergenic