ID: 912542240

View in Genome Browser
Species Human (GRCh38)
Location 1:110425819-110425841
Sequence AACGGACACAGGGGGACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542240_912542245 -9 Left 912542240 1:110425819-110425841 CCTGGTGTCCCCCTGTGTCCGTT No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542240_912542251 10 Left 912542240 1:110425819-110425841 CCTGGTGTCCCCCTGTGTCCGTT No data
Right 912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG No data
912542240_912542252 11 Left 912542240 1:110425819-110425841 CCTGGTGTCCCCCTGTGTCCGTT No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542240_912542248 4 Left 912542240 1:110425819-110425841 CCTGGTGTCCCCCTGTGTCCGTT No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542240 Original CRISPR AACGGACACAGGGGGACACC AGG (reversed) Intergenic
No off target data available for this crispr