ID: 912542242

View in Genome Browser
Species Human (GRCh38)
Location 1:110425828-110425850
Sequence CAGTGGCAAAACGGACACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542242_912542248 -5 Left 912542242 1:110425828-110425850 CCCCTGTGTCCGTTTTGCCACTG No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542242_912542251 1 Left 912542242 1:110425828-110425850 CCCCTGTGTCCGTTTTGCCACTG No data
Right 912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG No data
912542242_912542252 2 Left 912542242 1:110425828-110425850 CCCCTGTGTCCGTTTTGCCACTG No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542242 Original CRISPR CAGTGGCAAAACGGACACAG GGG (reversed) Intergenic
No off target data available for this crispr