ID: 912542244

View in Genome Browser
Species Human (GRCh38)
Location 1:110425830-110425852
Sequence GGCAGTGGCAAAACGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542244_912542251 -1 Left 912542244 1:110425830-110425852 CCTGTGTCCGTTTTGCCACTGCC No data
Right 912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG No data
912542244_912542248 -7 Left 912542244 1:110425830-110425852 CCTGTGTCCGTTTTGCCACTGCC No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542244_912542252 0 Left 912542244 1:110425830-110425852 CCTGTGTCCGTTTTGCCACTGCC No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542244 Original CRISPR GGCAGTGGCAAAACGGACAC AGG (reversed) Intergenic
No off target data available for this crispr