ID: 912542245

View in Genome Browser
Species Human (GRCh38)
Location 1:110425833-110425855
Sequence GTGTCCGTTTTGCCACTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542240_912542245 -9 Left 912542240 1:110425819-110425841 CCTGGTGTCCCCCTGTGTCCGTT No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542237_912542245 -3 Left 912542237 1:110425813-110425835 CCCCATCCTGGTGTCCCCCTGTG No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542235_912542245 8 Left 912542235 1:110425802-110425824 CCCAGGCTCAGCCCCATCCTGGT No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542232_912542245 22 Left 912542232 1:110425788-110425810 CCTTTGGAGCCATGCCCAGGCTC No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542238_912542245 -4 Left 912542238 1:110425814-110425836 CCCATCCTGGTGTCCCCCTGTGT No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542236_912542245 7 Left 912542236 1:110425803-110425825 CCAGGCTCAGCCCCATCCTGGTG No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542233_912542245 13 Left 912542233 1:110425797-110425819 CCATGCCCAGGCTCAGCCCCATC No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542239_912542245 -5 Left 912542239 1:110425815-110425837 CCATCCTGGTGTCCCCCTGTGTC No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542245 Original CRISPR GTGTCCGTTTTGCCACTGCC CGG Intergenic
No off target data available for this crispr