ID: 912542246 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:110425837-110425859 |
Sequence | GTAGCCGGGCAGTGGCAAAA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912542246_912542252 | -7 | Left | 912542246 | 1:110425837-110425859 | CCGTTTTGCCACTGCCCGGCTAC | No data | ||
Right | 912542252 | 1:110425853-110425875 | CGGCTACTTCACTTGGCCATGGG | No data | ||||
912542246_912542251 | -8 | Left | 912542246 | 1:110425837-110425859 | CCGTTTTGCCACTGCCCGGCTAC | No data | ||
Right | 912542251 | 1:110425852-110425874 | CCGGCTACTTCACTTGGCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912542246 | Original CRISPR | GTAGCCGGGCAGTGGCAAAA CGG (reversed) | Intergenic | ||