ID: 912542246

View in Genome Browser
Species Human (GRCh38)
Location 1:110425837-110425859
Sequence GTAGCCGGGCAGTGGCAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542246_912542252 -7 Left 912542246 1:110425837-110425859 CCGTTTTGCCACTGCCCGGCTAC No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542246_912542251 -8 Left 912542246 1:110425837-110425859 CCGTTTTGCCACTGCCCGGCTAC No data
Right 912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542246 Original CRISPR GTAGCCGGGCAGTGGCAAAA CGG (reversed) Intergenic
No off target data available for this crispr