ID: 912542248

View in Genome Browser
Species Human (GRCh38)
Location 1:110425846-110425868
Sequence CACTGCCCGGCTACTTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542240_912542248 4 Left 912542240 1:110425819-110425841 CCTGGTGTCCCCCTGTGTCCGTT No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542243_912542248 -6 Left 912542243 1:110425829-110425851 CCCTGTGTCCGTTTTGCCACTGC No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542239_912542248 8 Left 912542239 1:110425815-110425837 CCATCCTGGTGTCCCCCTGTGTC No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542238_912542248 9 Left 912542238 1:110425814-110425836 CCCATCCTGGTGTCCCCCTGTGT No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542242_912542248 -5 Left 912542242 1:110425828-110425850 CCCCTGTGTCCGTTTTGCCACTG No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542241_912542248 -4 Left 912542241 1:110425827-110425849 CCCCCTGTGTCCGTTTTGCCACT No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542235_912542248 21 Left 912542235 1:110425802-110425824 CCCAGGCTCAGCCCCATCCTGGT No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542244_912542248 -7 Left 912542244 1:110425830-110425852 CCTGTGTCCGTTTTGCCACTGCC No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542233_912542248 26 Left 912542233 1:110425797-110425819 CCATGCCCAGGCTCAGCCCCATC No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542236_912542248 20 Left 912542236 1:110425803-110425825 CCAGGCTCAGCCCCATCCTGGTG No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data
912542237_912542248 10 Left 912542237 1:110425813-110425835 CCCCATCCTGGTGTCCCCCTGTG No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542248 Original CRISPR CACTGCCCGGCTACTTCACT TGG Intergenic
No off target data available for this crispr