ID: 912542252

View in Genome Browser
Species Human (GRCh38)
Location 1:110425853-110425875
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542243_912542252 1 Left 912542243 1:110425829-110425851 CCCTGTGTCCGTTTTGCCACTGC No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542237_912542252 17 Left 912542237 1:110425813-110425835 CCCCATCCTGGTGTCCCCCTGTG No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542244_912542252 0 Left 912542244 1:110425830-110425852 CCTGTGTCCGTTTTGCCACTGCC No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542235_912542252 28 Left 912542235 1:110425802-110425824 CCCAGGCTCAGCCCCATCCTGGT No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542239_912542252 15 Left 912542239 1:110425815-110425837 CCATCCTGGTGTCCCCCTGTGTC No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542236_912542252 27 Left 912542236 1:110425803-110425825 CCAGGCTCAGCCCCATCCTGGTG No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542242_912542252 2 Left 912542242 1:110425828-110425850 CCCCTGTGTCCGTTTTGCCACTG No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542238_912542252 16 Left 912542238 1:110425814-110425836 CCCATCCTGGTGTCCCCCTGTGT No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542246_912542252 -7 Left 912542246 1:110425837-110425859 CCGTTTTGCCACTGCCCGGCTAC No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542241_912542252 3 Left 912542241 1:110425827-110425849 CCCCCTGTGTCCGTTTTGCCACT No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data
912542240_912542252 11 Left 912542240 1:110425819-110425841 CCTGGTGTCCCCCTGTGTCCGTT No data
Right 912542252 1:110425853-110425875 CGGCTACTTCACTTGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type