ID: 912543357

View in Genome Browser
Species Human (GRCh38)
Location 1:110433504-110433526
Sequence CTCCCTCTCCACCCTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912543350_912543357 27 Left 912543350 1:110433454-110433476 CCTAGTGGGATAGAGTTGATAAA No data
Right 912543357 1:110433504-110433526 CTCCCTCTCCACCCTAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912543357 Original CRISPR CTCCCTCTCCACCCTAATGG AGG Intergenic
No off target data available for this crispr