ID: 912547418

View in Genome Browser
Species Human (GRCh38)
Location 1:110460936-110460958
Sequence CCTGGTATCCAGAGGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912547405_912547418 26 Left 912547405 1:110460887-110460909 CCAAATCTGCATTTCTGTCATTC No data
Right 912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG No data
912547404_912547418 27 Left 912547404 1:110460886-110460908 CCCAAATCTGCATTTCTGTCATT No data
Right 912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG No data
912547408_912547418 2 Left 912547408 1:110460911-110460933 CCTTGGTCAAGGCTTCCACCCTC No data
Right 912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG No data
912547403_912547418 28 Left 912547403 1:110460885-110460907 CCCCAAATCTGCATTTCTGTCAT No data
Right 912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912547418 Original CRISPR CCTGGTATCCAGAGGGAGGC CGG Intergenic
No off target data available for this crispr