ID: 912555421

View in Genome Browser
Species Human (GRCh38)
Location 1:110512655-110512677
Sequence CCGGAGCCTGCTCCTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912555407_912555421 18 Left 912555407 1:110512614-110512636 CCTATTATGCAGGTTGGGTGAGG No data
Right 912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG No data
912555403_912555421 27 Left 912555403 1:110512605-110512627 CCTGTGATCCCTATTATGCAGGT No data
Right 912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG No data
912555406_912555421 19 Left 912555406 1:110512613-110512635 CCCTATTATGCAGGTTGGGTGAG No data
Right 912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912555421 Original CRISPR CCGGAGCCTGCTCCTTGTTG GGG Intergenic
No off target data available for this crispr