ID: 912555797

View in Genome Browser
Species Human (GRCh38)
Location 1:110515123-110515145
Sequence CATGATAAGCCAGCTGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912555797_912555802 6 Left 912555797 1:110515123-110515145 CCCACATCAGCTGGCTTATCATG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 912555802 1:110515152-110515174 AAGTTGTGTGGAGGCATCTGAGG 0: 1
1: 0
2: 1
3: 20
4: 193
912555797_912555800 -6 Left 912555797 1:110515123-110515145 CCCACATCAGCTGGCTTATCATG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 912555800 1:110515140-110515162 ATCATGAAGTGGAAGTTGTGTGG 0: 1
1: 0
2: 1
3: 11
4: 200
912555797_912555803 28 Left 912555797 1:110515123-110515145 CCCACATCAGCTGGCTTATCATG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 912555803 1:110515174-110515196 GTTGCAGCACTGTGTCTTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 127
912555797_912555801 -3 Left 912555797 1:110515123-110515145 CCCACATCAGCTGGCTTATCATG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 912555801 1:110515143-110515165 ATGAAGTGGAAGTTGTGTGGAGG 0: 1
1: 0
2: 2
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912555797 Original CRISPR CATGATAAGCCAGCTGATGT GGG (reversed) Intergenic
905889914 1:41512618-41512640 TTTAATAAGCCAGCTGATTTAGG + Intronic
908067266 1:60420422-60420444 CATGGTAGGCCAGCTGCTGATGG + Intergenic
912555797 1:110515123-110515145 CATGATAAGCCAGCTGATGTGGG - Intergenic
915238202 1:154501580-154501602 CTTGATGAGCCTGTTGATGTAGG + Exonic
916002471 1:160630193-160630215 CATGTGAAGCCAGTGGATGTGGG - Intronic
916603808 1:166321448-166321470 AATTAGAAGCCAGCTGATCTGGG - Intergenic
919772650 1:201172549-201172571 CAGGCTAAGCCAGCTGCAGTTGG - Intergenic
921452892 1:215330434-215330456 CATGATATGCAAGCAGATGAAGG - Intergenic
921593413 1:217029213-217029235 CATGATTAACCAGCTGGTGGGGG + Intronic
921747058 1:218751425-218751447 CATGAAAAGCTCGCTGTTGTTGG + Intergenic
1067581768 10:47450857-47450879 CAGGACAAGCCAGCTGAAGTCGG + Intergenic
1072032875 10:91538144-91538166 CATGACAAGCACGCTGCTGTGGG + Intergenic
1073499507 10:103923062-103923084 CAAGATAAGCCAAATGATGGTGG - Intergenic
1086915252 11:92522694-92522716 CTTCATAAGCCAGCTGATACTGG - Intronic
1089869731 11:121661445-121661467 ACTGACAACCCAGCTGATGTGGG - Intergenic
1090467420 11:126947040-126947062 CATGAAAACCAAGCTGATGTAGG - Intronic
1096253863 12:50051168-50051190 CTTGAAAAGCCAACTGATGCAGG + Intergenic
1099898492 12:88678853-88678875 CAAGATAAGTCACATGATGTAGG + Intergenic
1100214044 12:92429177-92429199 CTTGATGAGGCAGGTGATGTGGG - Exonic
1104619776 12:130302263-130302285 CAGGATAAGGCAGATGTTGTGGG + Intergenic
1105591478 13:21796723-21796745 CATGCTCAGCGAACTGATGTTGG - Intergenic
1106607766 13:31247043-31247065 CTTGTTTAGCCAGCTGATGAAGG - Exonic
1107740681 13:43446733-43446755 CATGAGAACCAAGCTGATTTGGG - Intronic
1110325609 13:74211286-74211308 CATGATAAGCCAGCTCACTCTGG - Intergenic
1111016044 13:82383414-82383436 AATGATGACCTAGCTGATGTTGG + Intergenic
1117671146 14:58107283-58107305 CAAGATTAGACAGCAGATGTTGG - Intronic
1119421889 14:74512128-74512150 CATGATATGCCAGGTTATGTCGG - Intronic
1119799871 14:77434468-77434490 CTTGATAAGCCAGCTTATAGTGG - Intronic
1120611996 14:86653377-86653399 CATGATGAGACAGCTGATTCCGG + Intergenic
1121169452 14:91841342-91841364 CAACTTAAGCAAGCTGATGTGGG - Intronic
1124148847 15:27158765-27158787 CATGATAAACCATGTCATGTGGG + Intronic
1133246859 16:4454910-4454932 CATGATATCCCAGCCGAGGTAGG + Exonic
1135885702 16:26305196-26305218 CATGTCAGGCCAGTTGATGTGGG - Intergenic
1140841721 16:78845793-78845815 CATTATAAGCTGGCTTATGTGGG + Intronic
1141216193 16:82026350-82026372 CATCATAAGCCAGATGTTGCAGG - Intergenic
1141801158 16:86310144-86310166 CATGACAAGCCGGCTGGTGCTGG - Intergenic
1144566621 17:16364622-16364644 CATCATCCTCCAGCTGATGTTGG - Intergenic
1145321174 17:21768223-21768245 CAGGAGAAGCCAGCTGCCGTGGG + Intergenic
1149967613 17:61181794-61181816 CATGATATGACAGCAGAGGTTGG + Intronic
1151075034 17:71261680-71261702 CATGATTGGCCAGCTGAGGTTGG - Intergenic
1156111029 18:33727636-33727658 CATTATAAGACAGGTGATTTTGG + Intronic
1163717382 19:18880021-18880043 AAGGATAAGCCAGGTGAGGTGGG - Intronic
1164130554 19:22357664-22357686 CATGAAAAGCTTGCTGCTGTTGG + Intergenic
1165543929 19:36517474-36517496 AAAGAAAAGCCAGCAGATGTGGG + Intronic
925500774 2:4501813-4501835 CATGATAAGCCTTCTGCTTTAGG + Intergenic
926994048 2:18714788-18714810 CAGGCAAAGCCAGCTTATGTAGG + Intergenic
928915863 2:36469579-36469601 CATGAGGAGCAAGCTGATGCTGG - Intronic
930488231 2:52035776-52035798 CCTGATAAGCTAGCTTTTGTAGG + Intergenic
931592410 2:63899865-63899887 CATTCTAAGCTAGGTGATGTTGG + Intronic
932110189 2:68992298-68992320 CAAGAGAAGCATGCTGATGTAGG - Intergenic
933437407 2:82265263-82265285 CTTGACAAGCCAACTGATTTGGG - Intergenic
939772734 2:146342851-146342873 GATGAACAGCCAGCTTATGTAGG - Intergenic
940007259 2:149019380-149019402 CCTGAAAAGACAGCTGAGGTGGG + Intronic
941147851 2:161874772-161874794 CATTATAAACTAGCTGATCTTGG + Intronic
942686117 2:178533800-178533822 TATAATAAGACAGCTTATGTAGG - Exonic
943328177 2:186526389-186526411 CAAAATAAGCCAGCTTATTTTGG + Intergenic
946731327 2:222712304-222712326 CTGGATAACCCAGCGGATGTTGG - Intergenic
1173641285 20:44603959-44603981 GAGGATGAGCCAACTGATGTTGG + Intronic
1178305917 21:31489820-31489842 CATGAACAGCCAGATGAAGTGGG - Intronic
1179682134 21:43030055-43030077 CAAGACCAGCCCGCTGATGTGGG - Exonic
1184401279 22:44276106-44276128 CATGATGAGGCAGCTGAAGGAGG + Intronic
1184708381 22:46231753-46231775 CAAGGTAAGTCAGGTGATGTGGG - Intronic
949253116 3:2011324-2011346 CTTGAGAACCCTGCTGATGTGGG - Intergenic
950414132 3:12858681-12858703 CAGGATCAGCCAGCTGGGGTGGG + Intronic
953693798 3:45142184-45142206 GATGATAAGACCACTGATGTGGG - Intronic
953771650 3:45782186-45782208 CACGATAAGCATGATGATGTAGG + Exonic
954691332 3:52397147-52397169 GATGAAAAGACAGCTGATGGAGG - Intronic
958970884 3:100609163-100609185 CATGATAACCCACCTGCTATGGG - Intergenic
960611969 3:119562864-119562886 CATCATAGGGCAGCTGATCTAGG + Intergenic
961331844 3:126147200-126147222 CATGACAGTCCAGCTGATGGAGG + Intronic
964789936 3:160444519-160444541 CATTATAGGACAGCTCATGTGGG - Intronic
965926251 3:173984230-173984252 CATAATAAGCCAGCAGAAGCAGG - Intronic
967029678 3:185594040-185594062 CTTTATAAGGCAGGTGATGTTGG + Intronic
967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG + Intergenic
971382393 4:26110842-26110864 CCTGAGAAGGCAGCTGATGCCGG - Intergenic
974002069 4:56521897-56521919 AATGATAAGCCACCAGATGCTGG - Intronic
977810883 4:101354607-101354629 CATGAAAAGTCAGATTATGTAGG + Intergenic
980209937 4:129773927-129773949 CATGAAAAGCAAGCAAATGTAGG - Intergenic
980576426 4:134688165-134688187 CAGGAGAAGCTAGCAGATGTGGG + Intergenic
984115197 4:175671596-175671618 CGTGATATGCAAGCTGAGGTGGG + Intronic
996188009 5:120503613-120503635 CATAATAATCCAGCTGTTGGAGG + Intronic
997753631 5:136373896-136373918 GATGACAGGCCGGCTGATGTTGG - Intronic
998587498 5:143442811-143442833 CTTGACAACCCAGCTGATGCAGG + Intergenic
1000571368 5:162917993-162918015 CATAATAAGCCAGCTATTGGTGG - Intergenic
1003391443 6:5716742-5716764 CAAAATAAGCCAGTAGATGTTGG - Intronic
1003523034 6:6874780-6874802 CCTGATATCCCAGCTGCTGTTGG - Intergenic
1004122376 6:12836876-12836898 CTTGATAAGCCAGCTTCTGGTGG - Intronic
1005431536 6:25763174-25763196 CATGGTAGGCCAGATGTTGTAGG - Intronic
1011565249 6:88666157-88666179 CATGAAAAGCCTGTTGCTGTTGG - Intronic
1012695103 6:102370904-102370926 CATGATAGGCCTGCTAATTTTGG + Intergenic
1012974422 6:105764782-105764804 CAGGAAAAGTCAGCTGAAGTTGG - Intergenic
1015585822 6:134775218-134775240 CATAAAAAGCCTGCTGGTGTTGG - Intergenic
1015843398 6:137495507-137495529 CATAATAAACTATCTGATGTCGG + Intergenic
1018764048 6:166915976-166915998 CATAATAAGTCAGCTGGTGTAGG - Intronic
1020594059 7:10182173-10182195 CATGAAGAGCCAGGTGGTGTTGG - Intergenic
1021909018 7:25365520-25365542 CATGAGCAGACAGCTAATGTAGG + Intergenic
1029657068 7:101934022-101934044 CATTATTAGCCAGCTGATGGGGG - Intronic
1032703643 7:134403808-134403830 CAGGGTAAGGCAGCTGCTGTGGG + Intergenic
1032979464 7:137265068-137265090 CATGAAAAGCTTGCTGCTGTTGG + Intronic
1033158673 7:138978617-138978639 CAAGAGAAGCCAGCTGAAGGAGG + Intronic
1033522138 7:142171423-142171445 CATGATGAGCCACCTGCGGTAGG + Intronic
1043845895 8:85163731-85163753 CATGAGCAGCCATCTGATTTTGG - Intergenic
1043951145 8:86310390-86310412 CATGATAGGCCATCTGAAGCTGG - Intronic
1045562324 8:103276829-103276851 CATGATTAATCAGCTGATTTTGG - Intergenic
1047078532 8:121433482-121433504 CATGAGAACTCAGTTGATGTGGG - Intergenic
1048894854 8:138982748-138982770 GATGATAAGGCAGCTGAGATTGG - Intergenic
1048999056 8:139813277-139813299 CATGACAAGGCACCTGCTGTGGG + Intronic
1049524478 8:143115522-143115544 GATGAGAAGTCAGCTCATGTTGG + Intergenic
1057323825 9:94041113-94041135 CATGATAAGGCTGATTATGTTGG - Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1186558612 X:10586941-10586963 CATGAAAAGCTTGCTGCTGTTGG + Intronic
1193247394 X:79244771-79244793 CATGATGAGCCACCTGTAGTTGG - Intergenic
1194979570 X:100426600-100426622 CATGGTAAGCCACCTGCTTTAGG - Intergenic
1199282250 X:146015802-146015824 GATCCTAAGCAAGCTGATGTAGG + Intergenic
1199379596 X:147154100-147154122 AATGATGAGCCAGCTAATATGGG + Intergenic
1201541841 Y:15113438-15113460 CATGATAAGACCACTTATGTGGG + Intergenic
1202245614 Y:22817040-22817062 CATGATAATCAAGCTTATATTGG + Intergenic
1202398603 Y:24450788-24450810 CATGATAATCAAGCTTATATTGG + Intergenic
1202472178 Y:25219298-25219320 CATGATAATCAAGCTTATATTGG - Intergenic