ID: 912556345

View in Genome Browser
Species Human (GRCh38)
Location 1:110518781-110518803
Sequence CATCCATTCTAGGGGAGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912556338_912556345 -2 Left 912556338 1:110518760-110518782 CCATTTCTTTCCAGCCACACACA 0: 1
1: 0
2: 4
3: 51
4: 531
Right 912556345 1:110518781-110518803 CATCCATTCTAGGGGAGCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 97
912556336_912556345 10 Left 912556336 1:110518748-110518770 CCAGCGCAACCTCCATTTCTTTC 0: 1
1: 0
2: 0
3: 35
4: 231
Right 912556345 1:110518781-110518803 CATCCATTCTAGGGGAGCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 97
912556337_912556345 1 Left 912556337 1:110518757-110518779 CCTCCATTTCTTTCCAGCCACAC 0: 1
1: 1
2: 6
3: 44
4: 388
Right 912556345 1:110518781-110518803 CATCCATTCTAGGGGAGCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912556345 Original CRISPR CATCCATTCTAGGGGAGCCA GGG Exonic
901440234 1:9273294-9273316 CATCCTCTCTAGGGGAGGGAGGG + Intergenic
912556345 1:110518781-110518803 CATCCATTCTAGGGGAGCCAGGG + Exonic
913681347 1:121188679-121188701 CAATCATTAGAGGGGAGCCATGG - Intronic
914033178 1:143976320-143976342 CAATCATTAGAGGGGAGCCATGG - Intergenic
914156268 1:145091646-145091668 CAATCATTAGAGGGGAGCCATGG + Intronic
915592744 1:156879957-156879979 CATCAATTCCAGGGGCGCCTGGG - Intronic
915930151 1:160055280-160055302 CAGCCAGTCTAGGGGGGGCAGGG + Intronic
916352562 1:163868047-163868069 CAACCCTTCTATGGGAGCCAAGG + Intergenic
920159589 1:203986115-203986137 CTTCCATTCTAGGGGTATCAGGG + Intergenic
920468663 1:206207205-206207227 CAATCATTAGAGGGGAGCCATGG - Intronic
921932326 1:220764902-220764924 CATCCATTATAGGTCAGGCATGG + Intronic
923999172 1:239531947-239531969 TATCCATTCTAGGCCAGGCACGG - Intronic
1065968491 10:30787263-30787285 CGCCCATTCTGGGGGAACCATGG + Intergenic
1069276732 10:66600738-66600760 CATCCTTTCTAATGGAGCTAAGG + Intronic
1070711809 10:78688650-78688672 CCTCCATTGTAGGGGAGGCCTGG - Intergenic
1076601365 10:131658926-131658948 CATCCATCCAGGGGGAGCCAGGG + Intergenic
1078476790 11:11637017-11637039 CCACCATTTTAGGGCAGCCATGG + Intergenic
1078539216 11:12199949-12199971 CACCCAGACTTGGGGAGCCAGGG - Intronic
1079299477 11:19264984-19265006 CATTGCTTCTAGGGGAGTCATGG - Intergenic
1080560750 11:33460216-33460238 CTTCCATTCCAGTGAAGCCAAGG - Intergenic
1084452211 11:69245859-69245881 CATCCATTCTGGGGCTGCCGTGG - Intergenic
1087375290 11:97332226-97332248 CAACCATTGTCGAGGAGCCAGGG + Intergenic
1088879985 11:113965504-113965526 CTTACATTCTAGTGGAGGCAGGG + Intergenic
1093730606 12:22561692-22561714 CATCCAGTCAAGGGGATCAAGGG - Intergenic
1104016895 12:124967590-124967612 CATCCATTCTCTGGGAGACTGGG - Intronic
1104433588 12:128737561-128737583 CATTCCTTCTAGGGGCTCCAGGG + Intergenic
1106801303 13:33259123-33259145 CTTCCATTCTAGTGGGGGCAGGG - Intronic
1106836225 13:33638134-33638156 TCTCCTTTCTAGGAGAGCCAGGG - Intergenic
1106907284 13:34422079-34422101 CATCCATTCAAAGACAGCCAAGG - Intergenic
1113389779 13:109884549-109884571 CATCCATACTGAGGGGGCCATGG + Intergenic
1114574662 14:23701128-23701150 CAGCCAATCCAGGGCAGCCAAGG - Intergenic
1118403973 14:65405265-65405287 CATCCATTGCAGGGGAGACTAGG + Intergenic
1120922886 14:89771192-89771214 CAGCCATGCTAGCAGAGCCAAGG - Intergenic
1126607109 15:50489004-50489026 CATACATTCTAGGCCAGGCAGGG - Intronic
1128091485 15:64922049-64922071 CATCCAGGCCAGGGGAGCCGAGG - Intronic
1132853003 16:2033227-2033249 CACCCATCCCCGGGGAGCCAGGG + Intronic
1139380225 16:66525852-66525874 CATGCATTCTGGGAGGGCCAGGG + Intronic
1141442891 16:84040886-84040908 CATCCATCCTAGGCCAGGCACGG + Intronic
1144759531 17:17699611-17699633 CATCCATTGTCGGGGGGCCGGGG + Intronic
1145795172 17:27651286-27651308 CAGCCATTTCAGAGGAGCCATGG + Intergenic
1145809625 17:27756637-27756659 CAGCCATTTCAGAGGAGCCATGG + Intergenic
1153225577 18:2897334-2897356 CATCCATTCTAGGGTATGGAGGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156804793 18:41165054-41165076 CATTGTTTCTAGGGGAGCCCTGG + Intergenic
1157318937 18:46619681-46619703 CATCCCTTCTAGAGGTGACACGG + Intronic
1160254039 18:77232318-77232340 CAGCCATTTTAGGGGAGGGACGG + Intergenic
1163642733 19:18470628-18470650 CATCCCGTCTAGGGGTGCCCTGG + Intronic
1167156940 19:47744316-47744338 CAGCCATTCAAAGGGATCCATGG - Intergenic
927329448 2:21844709-21844731 CATGCATTCTGAGGAAGCCAGGG + Intergenic
928121395 2:28586313-28586335 CATCCATTCTATAGGAGCGGAGG - Intronic
928184371 2:29096342-29096364 CATCCAGGCGAGGGGAGCCTTGG - Intergenic
933903126 2:86863027-86863049 CACACATTGTATGGGAGCCAAGG - Intergenic
933986651 2:87597191-87597213 TATCTATTCTAGGGGTCCCATGG - Intergenic
935736441 2:106110344-106110366 CATGCATTCTTGGGGAGGCTAGG + Intronic
936307191 2:111353618-111353640 TATCTATTCTAGGGGTCCCATGG + Intergenic
938298212 2:130191786-130191808 CAGCCATCCTAGGGGTGGCAGGG + Exonic
939643531 2:144669284-144669306 CATCCATGCTGGGGGAGGCAAGG + Intergenic
942384060 2:175422890-175422912 CATTCCTTCTAGGGGTTCCAGGG + Intergenic
945699666 2:213153895-213153917 GATCCATTCAGGGGGAGGCAGGG - Intergenic
1169287621 20:4322581-4322603 CATTCATTTTAGGTGAGGCAGGG + Intergenic
1172475286 20:35232658-35232680 CATGCATTTTTGTGGAGCCATGG - Intronic
1176020157 20:62958653-62958675 CAGAGGTTCTAGGGGAGCCATGG - Intronic
1177274524 21:18891631-18891653 AATCCATTCTAGGGGATTGAGGG + Intergenic
1178424538 21:32468930-32468952 CTTCCTTTCTTGGGGAGCCAGGG - Intronic
1182140748 22:27955735-27955757 CATACATTCTCGTGGAGCAAAGG + Intergenic
950214136 3:11146240-11146262 CATCCATTCTGGAGGAGACATGG + Intronic
950465093 3:13148905-13148927 CATCCTTTCCAGGGGAGCCAAGG + Intergenic
951537296 3:23751543-23751565 CATTCTTTCTGGAGGAGCCAAGG - Intergenic
953438261 3:42896912-42896934 CATTCATTCTAGGGGTTCCTAGG - Intronic
956311369 3:67884312-67884334 GATCCAATGTAGGGGAGCCAGGG - Intergenic
960738422 3:120805488-120805510 CATTCCTCCTAGGGCAGCCATGG + Intergenic
961990183 3:131181359-131181381 CTTCCTTTCTGGGGGATCCAAGG - Intronic
962826537 3:139104748-139104770 GATCCCTGCTAGGGAAGCCAAGG - Intronic
974107761 4:57490058-57490080 CATCCAATGAAGGGAAGCCAAGG + Intergenic
980812617 4:137902424-137902446 CACACATTCCAGGAGAGCCATGG + Intergenic
981364779 4:143889655-143889677 CATCCATTCCAGGCCAGGCATGG - Intronic
981375276 4:144007926-144007948 CATCCATTCTAAGCCAGGCATGG - Intronic
981385894 4:144130127-144130149 CATCCATTCCAGGCCAGGCATGG - Intronic
985329697 4:188817696-188817718 CCTCCATTCTGGAGAAGCCATGG + Intergenic
996468622 5:123833298-123833320 GTTCCATTGTAGAGGAGCCAAGG - Intergenic
999431736 5:151530965-151530987 GCACCATTCCAGGGGAGCCATGG + Intronic
1001087998 5:168715463-168715485 CATGCAACCTAAGGGAGCCAAGG + Intronic
1001395097 5:171413143-171413165 CATTATTTCTAAGGGAGCCAAGG - Intergenic
1006017312 6:31092240-31092262 AATCCAATCAAAGGGAGCCAAGG - Intergenic
1012381631 6:98626538-98626560 CATCCCTTCTAGGCCAGCCTTGG - Intergenic
1016878675 6:148888838-148888860 CCTCTATTCTAGAGGAGCAAAGG + Intronic
1018240528 6:161769959-161769981 AATCCATCCTGGGAGAGCCAGGG + Intronic
1019599420 7:1873868-1873890 CATCCATTCTCGTTCAGCCACGG - Intronic
1021767109 7:23960873-23960895 CATCCACTCAAGGTGACCCACGG - Intergenic
1022177226 7:27883133-27883155 CATTCTTTCTTGGGGAGACAGGG + Intronic
1023874828 7:44281300-44281322 CATCCATGATGGGGCAGCCACGG + Intronic
1037375409 8:18222170-18222192 CATCCATTGTGGGGATGCCATGG + Exonic
1044159313 8:88893423-88893445 TATACATTCCAGGAGAGCCAGGG - Intergenic
1047063234 8:121251033-121251055 TATCCATTCCAGGGAAGCCATGG + Intergenic
1049072226 8:140365017-140365039 CACTCTTTCTGGGGGAGCCAGGG + Intronic
1056445986 9:86666631-86666653 CATCCATTCTAATGGGGCCTAGG + Intergenic
1059428679 9:114236969-114236991 GATCTCTTCCAGGGGAGCCAGGG + Exonic
1059761586 9:117342844-117342866 CATCTCTTCTGGGGAAGCCAAGG + Intronic
1060745850 9:126130387-126130409 CATCCATTCTATGGGGGCCTGGG + Intergenic
1061751962 9:132785037-132785059 TCTCCATTTTGGGGGAGCCAGGG - Intronic
1062381594 9:136289578-136289600 CAGCCCTTGTGGGGGAGCCATGG - Intronic
1188019825 X:25144959-25144981 TATCCATTCCAGGGAAGGCAGGG + Intergenic
1188603917 X:32004893-32004915 CATCCACTCTAGGTTAGGCAAGG - Intronic
1190939191 X:55024578-55024600 CAGTCTTTCCAGGGGAGCCATGG - Intronic
1191880923 X:65843200-65843222 CATCCATCTTAGAGGAGTCAGGG - Intergenic
1193013693 X:76707839-76707861 AATCCATTCTAGGAGAGCTGAGG + Intergenic
1195663023 X:107400070-107400092 CTTCCATTCTAGAAAAGCCAGGG - Intergenic