ID: 912556746

View in Genome Browser
Species Human (GRCh38)
Location 1:110521754-110521776
Sequence GAAGCTGGTGCTCCAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912556746_912556753 22 Left 912556746 1:110521754-110521776 CCTCAGTTTGGAGCACCAGCTTC No data
Right 912556753 1:110521799-110521821 CAGCTCTCTTGTAAGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912556746 Original CRISPR GAAGCTGGTGCTCCAAACTG AGG (reversed) Intergenic
No off target data available for this crispr