ID: 912557951

View in Genome Browser
Species Human (GRCh38)
Location 1:110529836-110529858
Sequence CTGCTGTTCTCGAGGTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912557941_912557951 26 Left 912557941 1:110529787-110529809 CCTGAGTGAGCCATGGGTGCTCT No data
Right 912557951 1:110529836-110529858 CTGCTGTTCTCGAGGTAAAGAGG No data
912557945_912557951 16 Left 912557945 1:110529797-110529819 CCATGGGTGCTCTGGCTGGGTCA No data
Right 912557951 1:110529836-110529858 CTGCTGTTCTCGAGGTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912557951 Original CRISPR CTGCTGTTCTCGAGGTAAAG AGG Intergenic
No off target data available for this crispr