ID: 912558468

View in Genome Browser
Species Human (GRCh38)
Location 1:110533332-110533354
Sequence CCCCTTAGATGCCAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912558468_912558476 11 Left 912558468 1:110533332-110533354 CCAGCTTCCTGGCATCTAAGGGG No data
Right 912558476 1:110533366-110533388 CTGGGAGAGATGTGAACACCTGG No data
912558468_912558474 -7 Left 912558468 1:110533332-110533354 CCAGCTTCCTGGCATCTAAGGGG No data
Right 912558474 1:110533348-110533370 TAAGGGGTTTGTTTGGGCCTGGG No data
912558468_912558477 22 Left 912558468 1:110533332-110533354 CCAGCTTCCTGGCATCTAAGGGG No data
Right 912558477 1:110533377-110533399 GTGAACACCTGGCTCACACCTGG No data
912558468_912558473 -8 Left 912558468 1:110533332-110533354 CCAGCTTCCTGGCATCTAAGGGG No data
Right 912558473 1:110533347-110533369 CTAAGGGGTTTGTTTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912558468 Original CRISPR CCCCTTAGATGCCAGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr