ID: 912563230

View in Genome Browser
Species Human (GRCh38)
Location 1:110565354-110565376
Sequence TATTAGGTCCACTTCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912563227_912563230 28 Left 912563227 1:110565303-110565325 CCACACATGGGCTGTGTGGAGGT No data
Right 912563230 1:110565354-110565376 TATTAGGTCCACTTCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912563230 Original CRISPR TATTAGGTCCACTTCAGAGG TGG Intergenic
No off target data available for this crispr