ID: 912565232

View in Genome Browser
Species Human (GRCh38)
Location 1:110582773-110582795
Sequence GTCCCAGACCTTTCTCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912565231_912565232 -6 Left 912565231 1:110582756-110582778 CCTCTAATGCAAGTGGGGTCCCA No data
Right 912565232 1:110582773-110582795 GTCCCAGACCTTTCTCAGCTTGG No data
912565230_912565232 -3 Left 912565230 1:110582753-110582775 CCGCCTCTAATGCAAGTGGGGTC No data
Right 912565232 1:110582773-110582795 GTCCCAGACCTTTCTCAGCTTGG No data
912565227_912565232 0 Left 912565227 1:110582750-110582772 CCGCCGCCTCTAATGCAAGTGGG No data
Right 912565232 1:110582773-110582795 GTCCCAGACCTTTCTCAGCTTGG No data
912565225_912565232 7 Left 912565225 1:110582743-110582765 CCAGCAGCCGCCGCCTCTAATGC No data
Right 912565232 1:110582773-110582795 GTCCCAGACCTTTCTCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912565232 Original CRISPR GTCCCAGACCTTTCTCAGCT TGG Intergenic
No off target data available for this crispr