ID: 912565565

View in Genome Browser
Species Human (GRCh38)
Location 1:110585003-110585025
Sequence ATGGTCCCATTTTAGATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912565562_912565565 -9 Left 912565562 1:110584989-110585011 CCTGTGAACTATGTATGGTCCCA No data
Right 912565565 1:110585003-110585025 ATGGTCCCATTTTAGATCTGGGG No data
912565558_912565565 3 Left 912565558 1:110584977-110584999 CCCTGGGAAGGCCCTGTGAACTA No data
Right 912565565 1:110585003-110585025 ATGGTCCCATTTTAGATCTGGGG No data
912565559_912565565 2 Left 912565559 1:110584978-110585000 CCTGGGAAGGCCCTGTGAACTAT No data
Right 912565565 1:110585003-110585025 ATGGTCCCATTTTAGATCTGGGG No data
912565554_912565565 28 Left 912565554 1:110584952-110584974 CCTGGAAAATCTGCATGACATCT No data
Right 912565565 1:110585003-110585025 ATGGTCCCATTTTAGATCTGGGG No data
912565561_912565565 -8 Left 912565561 1:110584988-110585010 CCCTGTGAACTATGTATGGTCCC No data
Right 912565565 1:110585003-110585025 ATGGTCCCATTTTAGATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912565565 Original CRISPR ATGGTCCCATTTTAGATCTG GGG Intergenic
No off target data available for this crispr