ID: 912566555

View in Genome Browser
Species Human (GRCh38)
Location 1:110591845-110591867
Sequence CTATGCGCCAGGTGCTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912566550_912566555 18 Left 912566550 1:110591804-110591826 CCAAGAGAAAGGGCACACTCATA 0: 1
1: 0
2: 1
3: 18
4: 158
Right 912566555 1:110591845-110591867 CTATGCGCCAGGTGCTCATTTGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912566555 Original CRISPR CTATGCGCCAGGTGCTCATT TGG Intergenic
902330354 1:15728272-15728294 CCATGTGCCCGGTGCTCATCCGG - Exonic
902930451 1:19727342-19727364 CTATGTGCCAGGTGCTCCGTGGG + Intronic
903708847 1:25306820-25306842 CTCGGGGCCAGGTGCTCAGTAGG + Intronic
903718274 1:25385598-25385620 CTCGGGGCCAGGTGCTCAGTAGG - Intronic
908351783 1:63293085-63293107 TTATGGGGCAGGTACTCATTAGG - Intergenic
911615761 1:100009086-100009108 TTATGTGCCAGGTGCCCACTTGG + Intronic
912566555 1:110591845-110591867 CTATGCGCCAGGTGCTCATTTGG + Intergenic
922198084 1:223376924-223376946 CTATGTGCTAGGTGCTCTTCAGG - Intergenic
922419430 1:225449569-225449591 CTCTGCCCCAGGTGCTCCTCAGG - Intergenic
923154408 1:231264930-231264952 CTGTGGGCCAGGTGCTCACTGGG - Intronic
1063603511 10:7503168-7503190 CTCTGCTCCAAGTGGTCATTCGG + Intergenic
1065912187 10:30317798-30317820 CTATATGCTAGATGCTCATTGGG - Intronic
1072214354 10:93275490-93275512 CTATGTGCCAGGTGCTGTTTGGG + Intergenic
1075466304 10:122653389-122653411 CTATGAACCAGTTACTCATTAGG + Intergenic
1077479753 11:2808031-2808053 CACTGGGCCAGGTGCTCAGTGGG - Intronic
1083617420 11:64033259-64033281 CTGTGTGCCAGGTGCTGTTTAGG - Intronic
1088902477 11:114128590-114128612 CTGTGTGCCAGGTGCTAATAAGG - Intronic
1089480950 11:118804685-118804707 CCATGCCCTAGTTGCTCATTCGG + Intergenic
1089813281 11:121149033-121149055 CTATGTGCCAGGTTCTAAGTGGG + Intronic
1098444945 12:70556892-70556914 CTATGTGCCAGGTGCTCTTCTGG + Intronic
1099194709 12:79602153-79602175 CTATGTGTCAGATGGTCATTTGG - Intronic
1099878070 12:88433916-88433938 ATATGCCCCTGGTGCTCCTTGGG - Intergenic
1104434631 12:128746035-128746057 TCCTGCGCCAGGTGCTCGTTGGG - Intergenic
1106849804 13:33777767-33777789 CTCTGGGCCAGGTGCTCTTTTGG - Intergenic
1110111361 13:71750022-71750044 CTATGTGCCAGGTACTCTGTTGG + Intronic
1112593898 13:100790074-100790096 CTTTGTGCCAGATGGTCATTAGG - Intergenic
1114076058 14:19161776-19161798 CCATGACCCAGGTGGTCATTAGG - Intergenic
1114086099 14:19237795-19237817 CCATGACCCAGGTGGTCATTAGG + Intergenic
1118730180 14:68660544-68660566 CTCTGCACCAGGAGCTGATTCGG - Intronic
1118835402 14:69474315-69474337 CTATGTGCCAGCAGATCATTTGG - Intergenic
1128449087 15:67791534-67791556 CCCTGTGCCAGGTGCTCACTAGG - Intronic
1129296137 15:74601163-74601185 CTTTGCCTCAGGTGCTCTTTGGG - Intronic
1133436528 16:5784793-5784815 CTATGCGCCATGTCCTCACATGG - Intergenic
1138839072 16:60476001-60476023 CTATGTGCCAGGTTCTCCGTTGG + Intergenic
1139754646 16:69132587-69132609 CTATGCGCCAGGAGCACTTCCGG + Exonic
1144119970 17:12142763-12142785 CCATTAGCCAGGTTCTCATTAGG + Exonic
1150105422 17:62459282-62459304 CTATGGGCCAGGTCCTCCTGGGG + Intronic
1156405530 18:36779212-36779234 CAATGCCACAGGTGCTGATTTGG - Intronic
1163239321 19:16050523-16050545 CTCTTCTCCAGGTGCTCACTGGG - Intergenic
1164520180 19:28973116-28973138 CCATGCGCCACCTGTTCATTCGG - Intergenic
1164708675 19:30339250-30339272 CCATGGGCCAGGTGCTCTTTGGG + Intronic
1164869747 19:31632882-31632904 CTATGCGCCAGGAGCTGTTGGGG - Intergenic
932106329 2:68946234-68946256 CTATGTGCCAGGTGCTCTGTTGG - Intronic
935947784 2:108301720-108301742 CTATGTGCCAGGAACTTATTAGG - Intronic
938490653 2:131759297-131759319 CCATGACCCAGGTGGTCATTAGG - Intronic
944913459 2:204333029-204333051 CTATGTGCCAAGTGCTTTTTAGG - Intergenic
945901272 2:215540220-215540242 CTATGTGCCAGGTACTCAAATGG - Intergenic
1170594348 20:17793964-17793986 CAGTGCCCCAGGTCCTCATTCGG - Intergenic
1175417376 20:58810821-58810843 CTGTGGGCCAGGTCCTCATGTGG + Intergenic
1177716651 21:24847208-24847230 CTATGGGCCAGGGGCTCTCTGGG + Intergenic
1178615872 21:34132349-34132371 CTATGCGCCCGGGGCTGATGTGG - Intronic
1179618793 21:42598956-42598978 CTCTGCGGCAGGTGCTCTCTGGG + Intergenic
1180291868 22:10855398-10855420 CCATGACCCAGGTGGTCATTAGG - Intergenic
1180494672 22:15884820-15884842 CCATGACCCAGGTGGTCATTAGG - Intergenic
1181088606 22:20456960-20456982 CTATGGGCCAGGTACACCTTTGG - Intronic
1184416454 22:44354518-44354540 ATATGAGCCACTTGCTCATTGGG - Intergenic
951095382 3:18623841-18623863 CTATGTGCCAGGTTCTAGTTTGG + Intergenic
951441915 3:22733232-22733254 CTATGAGCCAGGTACTTAGTAGG + Intergenic
961074259 3:123966960-123966982 CTATGCCACAGCTGCTCACTAGG - Intergenic
961309367 3:125985170-125985192 CTATGCCACAGCTGCTCACTAGG + Intergenic
967101024 3:186215921-186215943 CTATGGGCCAGGTGCTGTGTAGG + Intronic
971150384 4:24025201-24025223 CTTTTCTTCAGGTGCTCATTGGG + Intergenic
971253260 4:24990990-24991012 CTCTGCTCCATGTGGTCATTCGG + Intergenic
971428367 4:26538087-26538109 TTATTGGCCAGGTACTCATTTGG + Intergenic
972368236 4:38395754-38395776 CTATGTGCCAAGTGCTTAATGGG + Intergenic
972461439 4:39307300-39307322 GTATGTGCCAGGTGCTCACGTGG - Intronic
978344174 4:107748998-107749020 CTTTGGGTCAGGTGCTCAGTTGG + Intergenic
992953371 5:81883088-81883110 CTATGTGCAAGGTGCTGACTAGG + Intergenic
996563769 5:124858165-124858187 CTATGTGCCAGGTACTGACTAGG - Intergenic
998970718 5:147589100-147589122 ATATGAGCCATATGCTCATTAGG - Exonic
1003736151 6:8879691-8879713 TTATGTGCAAGGTGCTCAGTAGG + Intergenic
1003972700 6:11314262-11314284 CTATGCACCAGGTGCTGAGCTGG - Intronic
1017656369 6:156633507-156633529 CTGTGTGCCAAGTCCTCATTCGG - Intergenic
1018054215 6:160037808-160037830 CTCTGCTCCATGTGGTCATTTGG + Intronic
1020124514 7:5526021-5526043 CTATGCACCAGGTGGTGTTTGGG + Intergenic
1021244596 7:18245988-18246010 CTATGTACCAGGTGCTTATCTGG + Intronic
1023491787 7:40750895-40750917 CTATGTGCCAGGTACTGCTTTGG + Intronic
1034946967 7:155268522-155268544 CTATATGCCAGGAGCTCTTTGGG - Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1049021297 8:139959332-139959354 CTCTGTGCCAGGTACTCTTTTGG + Intronic
1051359804 9:16271913-16271935 CTATGCCTCAGTTTCTCATTTGG - Intronic
1052110189 9:24572745-24572767 AAATGCACAAGGTGCTCATTAGG + Intergenic
1055071802 9:72174159-72174181 TTATTCAGCAGGTGCTCATTAGG + Intronic
1059946308 9:119411897-119411919 TTATGTGCCAAGTGCTCACTTGG + Intergenic
1060835620 9:126753346-126753368 CTTTGGGCCCGGTGCTCACTGGG - Intergenic
1061547102 9:131310816-131310838 CGGTGCGCCAGGTGCTCTTGGGG - Intergenic
1201150719 Y:11094241-11094263 CCATGACCCAGGTGGTCATTAGG + Intergenic