ID: 912567664

View in Genome Browser
Species Human (GRCh38)
Location 1:110599863-110599885
Sequence GACAGCTGGTAGCCTAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912567664_912567678 23 Left 912567664 1:110599863-110599885 CCTATATTAGGCTACCAGCTGTC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 912567678 1:110599909-110599931 CCAGGTTTCTGGTGGGAGGAAGG 0: 1
1: 0
2: 5
3: 42
4: 347
912567664_912567669 5 Left 912567664 1:110599863-110599885 CCTATATTAGGCTACCAGCTGTC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 912567669 1:110599891-110599913 TACTTTCACACCCTGCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 145
912567664_912567670 12 Left 912567664 1:110599863-110599885 CCTATATTAGGCTACCAGCTGTC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 912567670 1:110599898-110599920 ACACCCTGCACCCAGGTTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 153
912567664_912567672 15 Left 912567664 1:110599863-110599885 CCTATATTAGGCTACCAGCTGTC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 912567672 1:110599901-110599923 CCCTGCACCCAGGTTTCTGGTGG No data
912567664_912567674 16 Left 912567664 1:110599863-110599885 CCTATATTAGGCTACCAGCTGTC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 912567674 1:110599902-110599924 CCTGCACCCAGGTTTCTGGTGGG 0: 1
1: 0
2: 6
3: 22
4: 188
912567664_912567675 19 Left 912567664 1:110599863-110599885 CCTATATTAGGCTACCAGCTGTC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 912567675 1:110599905-110599927 GCACCCAGGTTTCTGGTGGGAGG 0: 1
1: 0
2: 0
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912567664 Original CRISPR GACAGCTGGTAGCCTAATAT AGG (reversed) Intronic
901444630 1:9300560-9300582 GACAGCTCTTGGCCTAATACTGG + Intronic
907358386 1:53894915-53894937 GAGAGAGGGTAGCCTAGTATGGG - Intronic
908205894 1:61848875-61848897 AACAGCAGGTAGCCAGATATTGG - Intronic
912567664 1:110599863-110599885 GACAGCTGGTAGCCTAATATAGG - Intronic
912690563 1:111801632-111801654 GACACCTGGTGGCCATATATTGG - Intronic
917107927 1:171513411-171513433 GAAAGCGGGGAGCCTAATAAAGG - Intronic
919912502 1:202120370-202120392 GACAGCTGGGATCCAAATGTAGG - Intergenic
1064583569 10:16817483-16817505 GAGAGCTGTTCTCCTAATATGGG - Intronic
1065792248 10:29271438-29271460 GACAGCTGGAAGCCTAACTCTGG - Intergenic
1068499354 10:57823654-57823676 GACAGATGATAGCATCATATTGG + Intergenic
1078081310 11:8206540-8206562 GACAGCTGGCAGCCCGATAAGGG + Intergenic
1078398212 11:11000848-11000870 GAAAGCTGGTGTCCTTATATGGG - Intergenic
1078612467 11:12832966-12832988 GACAACTGCTAGCATAATTTCGG - Intronic
1086558215 11:88136863-88136885 GACTGCTGGTATCCTAAGAATGG - Intronic
1087561193 11:99793028-99793050 GACTGCTAGTAGACTAATACAGG - Intronic
1088103076 11:106176124-106176146 GACAGCTGGAACTCTAAGATTGG + Intergenic
1098677494 12:73308979-73309001 GACAGTTGGTAGCTTAAAATGGG + Intergenic
1100173421 12:92003169-92003191 GACAGCTGGTTGCCACACATGGG - Intronic
1110059561 13:71024423-71024445 AACAGCTGGTACCATAGTATTGG - Intergenic
1112659272 13:101488815-101488837 GAGAACTGGGAACCTAATATTGG - Intronic
1114049172 14:18906411-18906433 GACAGATAGTAGCTTTATATTGG - Intergenic
1114113392 14:19495520-19495542 GACAGATAGTAGCTTTATATTGG + Intergenic
1114115097 14:19613274-19613296 GACAGATAGTAGCCTTATGTTGG + Intergenic
1118425695 14:65658810-65658832 TACAGCTTGTATCCTAATTTTGG + Intronic
1118587324 14:67367115-67367137 GACTCCAGGTAGCCTAATAGGGG + Intronic
1140034936 16:71364644-71364666 GACATCTGGCAGCCTAATGCTGG - Intronic
1142013090 16:87726814-87726836 GACATCTGGCAGCCTGATCTGGG + Exonic
1146742498 17:35298879-35298901 GACAGCTGGTAGCCTGAAAATGG + Intergenic
1148452061 17:47785354-47785376 GAAAGCTGCTAGCATAATACAGG - Intergenic
1149538545 17:57451460-57451482 GACAGCTGGGAGCCCACGATGGG - Intronic
1150358690 17:64509808-64509830 GACAGCTAATAGTCTAATAAGGG - Intronic
1156582551 18:38394471-38394493 GACAGCTCTTAGCCTATTACTGG + Intergenic
928728710 2:34206267-34206289 GAAAGCTGGAAGCCTCGTATGGG + Intergenic
939867699 2:147492506-147492528 GAAAGATGGGAGACTAATATGGG - Intergenic
941451845 2:165669507-165669529 GACAGCTTTGAGCCAAATATAGG - Intronic
944498904 2:200337834-200337856 GACAGCTGGCAGTCTATTATGGG - Intronic
945202688 2:207298854-207298876 CACACCTGTTAACCTAATATGGG - Intergenic
947678441 2:232007068-232007090 GATAGCTGGTAGCCTGAGGTGGG + Intronic
1170444092 20:16407187-16407209 GACAGCTGTGACCCTAAAATGGG - Intronic
959333806 3:105039353-105039375 GCCAGCTGCTAGACTAACATAGG + Intergenic
962672407 3:137722478-137722500 GATAGCTGTTAGCCAAATATTGG - Intergenic
964871145 3:161314859-161314881 GACAGCTGGTCTCCTTACATGGG - Intergenic
970704829 4:18787949-18787971 GAGATCAGGCAGCCTAATATAGG + Intergenic
970809623 4:20077224-20077246 TACAGATGATAGGCTAATATTGG + Intergenic
974652942 4:64778350-64778372 TACAGTTGGTATCATAATATAGG + Intergenic
976430803 4:84962194-84962216 GTAAGCTGGTAGCTTAATTTAGG + Intronic
977111102 4:92956148-92956170 GACAGATGGTATATTAATATGGG - Intronic
979728097 4:123989237-123989259 ACCAGCTGGTAGCCTATGATTGG - Intergenic
983263047 4:165476989-165477011 GAAAGCTTGTAGGCTAATATGGG - Intronic
990720323 5:58687673-58687695 GAGAGGAGGTAGCTTAATATTGG + Intronic
994367372 5:98930351-98930373 AACAGCTGGTAGCCTAAAACTGG - Intergenic
997708805 5:135985347-135985369 GACAGCTGTCAGTCTAATAGTGG - Intergenic
1002695276 5:181084491-181084513 GACAAATGGTAGCCAAATTTGGG + Intergenic
1006457888 6:34142520-34142542 GACAGCTGGCAGCAAAAGATGGG - Intronic
1007197752 6:40077382-40077404 GACAGTGGATAGCCTAACATAGG - Intergenic
1010167034 6:72927478-72927500 AACAGCTTTTAGCCTAATCTAGG + Intronic
1010791957 6:80075225-80075247 GGCAGCAGGTACCCTAAAATGGG + Intergenic
1011372272 6:86650076-86650098 GACAGGTGGTAGCCTGCTCTGGG - Intergenic
1018747630 6:166774711-166774733 GTCTGCTGGGAGCCCAATATGGG - Intronic
1028046007 7:86119697-86119719 TACAGCTGTTAACCTAACATCGG - Intergenic
1031344282 7:120645816-120645838 GACAAATGGCATCCTAATATAGG + Intronic
1033008311 7:137591415-137591437 GAGAACTATTAGCCTAATATTGG - Intronic
1038784297 8:30597047-30597069 CACAGCTGTTAGCCTCGTATGGG + Intronic
1039268857 8:35858521-35858543 GGCACCTGGTAGCCTCACATAGG - Intergenic
1040801761 8:51350166-51350188 GAAAGCTGGTCGCCCAAGATAGG + Intronic
1046056408 8:109083978-109084000 GACAGCAGGTAGCAGTATATGGG + Intergenic
1053170702 9:35879543-35879565 GACTTCAAGTAGCCTAATATAGG - Intergenic