ID: 912567667

View in Genome Browser
Species Human (GRCh38)
Location 1:110599885-110599907
Sequence TGCAGGGTGTGAAAGTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912567667_912567678 1 Left 912567667 1:110599885-110599907 CCCAGGTACTTTCACACCCTGCA No data
Right 912567678 1:110599909-110599931 CCAGGTTTCTGGTGGGAGGAAGG 0: 1
1: 0
2: 5
3: 42
4: 347
912567667_912567672 -7 Left 912567667 1:110599885-110599907 CCCAGGTACTTTCACACCCTGCA No data
Right 912567672 1:110599901-110599923 CCCTGCACCCAGGTTTCTGGTGG No data
912567667_912567675 -3 Left 912567667 1:110599885-110599907 CCCAGGTACTTTCACACCCTGCA No data
Right 912567675 1:110599905-110599927 GCACCCAGGTTTCTGGTGGGAGG 0: 1
1: 0
2: 0
3: 21
4: 193
912567667_912567674 -6 Left 912567667 1:110599885-110599907 CCCAGGTACTTTCACACCCTGCA No data
Right 912567674 1:110599902-110599924 CCTGCACCCAGGTTTCTGGTGGG 0: 1
1: 0
2: 6
3: 22
4: 188
912567667_912567679 9 Left 912567667 1:110599885-110599907 CCCAGGTACTTTCACACCCTGCA No data
Right 912567679 1:110599917-110599939 CTGGTGGGAGGAAGGTGAATTGG No data
912567667_912567670 -10 Left 912567667 1:110599885-110599907 CCCAGGTACTTTCACACCCTGCA No data
Right 912567670 1:110599898-110599920 ACACCCTGCACCCAGGTTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912567667 Original CRISPR TGCAGGGTGTGAAAGTACCT GGG (reversed) Intronic
No off target data available for this crispr