ID: 912567672

View in Genome Browser
Species Human (GRCh38)
Location 1:110599901-110599923
Sequence CCCTGCACCCAGGTTTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912567664_912567672 15 Left 912567664 1:110599863-110599885 CCTATATTAGGCTACCAGCTGTC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 912567672 1:110599901-110599923 CCCTGCACCCAGGTTTCTGGTGG No data
912567667_912567672 -7 Left 912567667 1:110599885-110599907 CCCAGGTACTTTCACACCCTGCA No data
Right 912567672 1:110599901-110599923 CCCTGCACCCAGGTTTCTGGTGG No data
912567668_912567672 -8 Left 912567668 1:110599886-110599908 CCAGGTACTTTCACACCCTGCAC No data
Right 912567672 1:110599901-110599923 CCCTGCACCCAGGTTTCTGGTGG No data
912567666_912567672 1 Left 912567666 1:110599877-110599899 CCAGCTGTCCCAGGTACTTTCAC No data
Right 912567672 1:110599901-110599923 CCCTGCACCCAGGTTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912567672 Original CRISPR CCCTGCACCCAGGTTTCTGG TGG Intronic
No off target data available for this crispr