ID: 912567884

View in Genome Browser
Species Human (GRCh38)
Location 1:110601481-110601503
Sequence TGTAGAGAGGAGGCCCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912567876_912567884 26 Left 912567876 1:110601432-110601454 CCAAGTGGCAAGGGAAGAGGTGA 0: 1
1: 0
2: 1
3: 22
4: 280
Right 912567884 1:110601481-110601503 TGTAGAGAGGAGGCCCGGGGTGG 0: 1
1: 0
2: 4
3: 40
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912567884 Original CRISPR TGTAGAGAGGAGGCCCGGGG TGG Intronic
900097331 1:945266-945288 GGTGGAGAGGAGCCCTGGGGAGG + Intronic
900271376 1:1791015-1791037 TGTGGAGGGGAGGCCAAGGGAGG - Intronic
900338062 1:2174565-2174587 TGTAACCAGGAGGCCCAGGGAGG + Intronic
900665611 1:3813532-3813554 AGGAGAGAGGAGGCCAGGCGCGG - Exonic
901218771 1:7570391-7570413 TGGAGGGAGGAAGCACGGGGAGG + Intronic
901553687 1:10015055-10015077 TGTTGAGAGTAGGCCAGGTGTGG + Intronic
901643116 1:10703051-10703073 TGCAGAGAGGAGGCCTGGAGGGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
901961269 1:12828407-12828429 TGAAGTGAGGAGGCCCAAGGGGG - Intronic
901981142 1:13034661-13034683 AGCAGAGAGGAGGCCCTGGGTGG - Intronic
901983260 1:13053277-13053299 TGAAGTGAGGAGGCCCAAGGGGG - Intronic
901998829 1:13175641-13175663 TGAAGTGAGGAGGCCCAAGGGGG + Intergenic
902017314 1:13318768-13318790 TGAAGTGAGGAGGCCCAAGGGGG + Intronic
902044356 1:13513790-13513812 TGGAGAGGGGAGGGGCGGGGAGG + Exonic
904035905 1:27558339-27558361 GGTAGAGAGGTGTCCTGGGGGGG + Exonic
904071127 1:27798334-27798356 TGTAGAGATGTTGCCCGGGCTGG - Intronic
904127328 1:28250478-28250500 TGTAGAGACGAGGTGGGGGGTGG - Intergenic
904676546 1:32202151-32202173 TGTAGAGAGGAAGGCAAGGGGGG + Intronic
905370967 1:37482559-37482581 AGGAGTGAGGAGGGCCGGGGAGG - Intronic
905726910 1:40259792-40259814 TGTAGAGATGTTGCCCGGGGTGG + Intronic
906210714 1:44010984-44011006 AGCAGAGGGGAAGCCCGGGGAGG - Intronic
906293102 1:44632415-44632437 GGGAGGGAGGAGGCCGGGGGTGG - Intronic
907078819 1:51602609-51602631 TGTAGAGACGAGGAGTGGGGCGG + Intronic
908212246 1:61912709-61912731 GGTAGAGAGGAGGGGAGGGGAGG + Intronic
910655097 1:89610580-89610602 CGCAGAGAGGAGCCCCGAGGTGG - Intergenic
912414575 1:109499235-109499257 GGGAGAGAGGAGGCCCAGGCTGG - Intronic
912567884 1:110601481-110601503 TGTAGAGAGGAGGCCCGGGGTGG + Intronic
913187807 1:116385834-116385856 AGTAGAGAAGAGGCCGGGTGCGG + Intronic
913324874 1:117618588-117618610 TGTAGAGAGGAGGGGTGGGAAGG + Intronic
914293388 1:146296338-146296360 TGTTGAGAGTAGACCGGGGGTGG + Intergenic
914554432 1:148747121-148747143 TGTTGAGAGTAGACCGGGGGTGG + Intergenic
915463981 1:156085232-156085254 GGTGCAGAGGAGGCCCAGGGTGG + Intronic
915557476 1:156668616-156668638 TGAGGAGAGGAGGACCTGGGGGG - Intergenic
915751190 1:158212650-158212672 GGCAGAGAGGAGCCCCGAGGTGG + Intergenic
915832049 1:159140391-159140413 TGTAGATAGGAGGACCCTGGAGG - Intronic
915882168 1:159683658-159683680 TGGAGAGAGGATGCACGGAGTGG - Intergenic
916080887 1:161231350-161231372 TGTAGCGAAGAGGCCCGCAGAGG + Exonic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
917621562 1:176801651-176801673 GGAAGAGAGGAGGCCAGGGAAGG + Intronic
921273388 1:213492142-213492164 TGCATAGAGGAGGCACGCGGAGG + Intergenic
922675212 1:227545250-227545272 TGGAGTGAGGAGGCCCAGGTGGG - Intergenic
1063536842 10:6891716-6891738 TGTAGGGAGAAGGCCAGGTGAGG - Intergenic
1063560136 10:7118586-7118608 TGCAGACAGGAGGCCGGGAGAGG - Intergenic
1065723981 10:28652799-28652821 TGGAGAGAGGAGGCAGGGGGAGG - Intergenic
1067072406 10:43143604-43143626 TTTTGAGAGGAGGCCCTGAGAGG + Intronic
1068226938 10:54117784-54117806 CGTGGAGAGGAGACCCAGGGTGG + Intronic
1068362342 10:55994125-55994147 TGTAAAGAGGTGGCCAGGCGTGG - Intergenic
1068527653 10:58148595-58148617 TGCAGAGATGAGGCCGGGCGTGG + Intergenic
1068605012 10:58995559-58995581 TGGAGACAGGAGGCTCTGGGGGG + Intergenic
1068861901 10:61855908-61855930 TGCAGAGGTGAGGCCTGGGGAGG + Intergenic
1069036264 10:63648936-63648958 AGTGGAGAGGAGGCCGGGTGTGG + Intergenic
1069570192 10:69490052-69490074 TAGAGAGAGGAGGCCTGGGATGG - Intronic
1069754022 10:70762257-70762279 TGGAGAGTGGAGGTCCTGGGGGG + Exonic
1070090685 10:73282172-73282194 TGCAGAGAGGAGGAGCGGAGGGG + Intronic
1070575489 10:77674128-77674150 TGTAAAGAGAAGGGCCAGGGAGG + Intergenic
1071826435 10:89330452-89330474 TTTAGAGAGGGGGCCAGGGATGG + Intronic
1072806174 10:98425168-98425190 TGCAGAGAGGAAGCCCGTGACGG + Intronic
1073524729 10:104169866-104169888 TGGAGAGAGGAGGGCCGAGTGGG - Intronic
1073796665 10:106995936-106995958 TGTAGAAATGAGGCCAGGTGCGG + Intronic
1074814075 10:117131697-117131719 GGAAGCGAGGAGGGCCGGGGAGG - Intronic
1075649845 10:124120154-124120176 TGTGGAGAGGAGGCCCAAGAGGG + Intergenic
1075746863 10:124734065-124734087 TGAAGAGAGGAGGGCAGGGAAGG - Intronic
1076245424 10:128943705-128943727 GGTAGAGAGGAGGGCTGGGCTGG + Intergenic
1076362138 10:129896905-129896927 AATAAAGAGGAGGCCTGGGGTGG - Intronic
1076595056 10:131620157-131620179 TAAAGAGAGGAGGCGGGGGGGGG + Intergenic
1076727127 10:132419185-132419207 TGAGGAGCGGAGGCCCAGGGAGG + Intergenic
1076994868 11:292957-292979 TGTTGAGTGGAGCCCCAGGGAGG + Exonic
1077556946 11:3230474-3230496 TGGGGAGAGGTGGCCCGGGGCGG + Intronic
1083804940 11:65067857-65067879 TGCAGAGAGGAGGCCCAGAGAGG - Intronic
1083937307 11:65876653-65876675 TGAAGACATGAGGCCCAGGGGGG + Intergenic
1084286256 11:68133012-68133034 TGTAAAGGGGAGGCCGGGCGCGG + Intergenic
1084892293 11:72242568-72242590 TGGAGAAATGAGGCCCAGGGTGG - Intronic
1085197841 11:74683159-74683181 TTTACAGATGAGGCCCAGGGAGG - Intergenic
1085409038 11:76280928-76280950 TGGAGAGATGAGGGCCTGGGTGG + Intergenic
1086336915 11:85810086-85810108 TGTGCAGAGGAAGCCCGGTGGGG - Intronic
1090786781 11:130056313-130056335 TGTAGAGATGTGGCCCAGGCTGG + Intergenic
1091685140 12:2556218-2556240 TGTAGGGAAGAGTCCAGGGGAGG - Intronic
1092217535 12:6693737-6693759 CGTAGAGAGGAGGAGAGGGGTGG - Intergenic
1096725709 12:53560210-53560232 AGTAAAGAGGAGGCCGGGTGCGG - Intronic
1099353574 12:81605423-81605445 AGGAGAGAGGAGGCGAGGGGAGG + Intronic
1100355155 12:93821825-93821847 TGTAGACAGCAGGCCAGGTGTGG + Intronic
1101319324 12:103659336-103659358 TGCAGAGAGGAGGCTGGGTGAGG + Intronic
1101716506 12:107317891-107317913 TGTCGAGCGGAGGCCCGTGGCGG - Intergenic
1101950570 12:109171638-109171660 TGTAAAGAGAAGGCCAGGCGTGG - Intronic
1102393993 12:112572927-112572949 TATAAAGGGGAGGCCAGGGGTGG - Intronic
1102627433 12:114246652-114246674 TGTAGAGAAAAGGGCCTGGGTGG + Intergenic
1103120002 12:118372526-118372548 TGTGGAGAGGAGACCCCGGGAGG - Intronic
1103620503 12:122184382-122184404 TCTAGAGAGTAGGCCAGGTGCGG - Intronic
1104864975 12:131948026-131948048 TGTAGAGATGAGGCCCAGGCTGG + Intergenic
1104895705 12:132162643-132162665 TGCCGTGAGGAGGCTCGGGGAGG + Intergenic
1105495170 13:20924165-20924187 TGTAGAGACCAGGCCGGGAGCGG + Intergenic
1105929008 13:25034384-25034406 GGTGGAGAGGAGGCCCCAGGAGG - Intergenic
1106804841 13:33295689-33295711 TGTGCAGAGGGTGCCCGGGGGGG + Intronic
1107130250 13:36887063-36887085 TGTAGAGACGAGGTCCAGGCTGG + Intronic
1109406787 13:61910732-61910754 TATAGAGAGGTGCCCCGGTGAGG - Intergenic
1109780792 13:67107463-67107485 AGTGGAGAGGAGGCCCAGAGTGG - Intronic
1113245587 13:108391259-108391281 TGTAGTGGGGAGGCTAGGGGAGG - Intergenic
1113425904 13:110208214-110208236 TGCAGAGAGGAGGCAAGTGGTGG - Intronic
1113579502 13:111419088-111419110 TGTAGAGAGGTGGGCAGGGCAGG + Intergenic
1113949976 13:114066415-114066437 GGGCGAGAGGAGGCCCGGGCAGG + Intronic
1114510593 14:23256660-23256682 TGAATAGAGGAGGCCAGGCGTGG - Intronic
1116448499 14:45039041-45039063 AGTGGAGAGGAGACCCGGAGTGG + Intronic
1116895308 14:50310509-50310531 TGTAGAGACGTTGCCCAGGGTGG - Intronic
1117148036 14:52855110-52855132 TTTATAGATGAGGCTCGGGGAGG - Intergenic
1118441975 14:65820699-65820721 TGTAAAGAGGAGGGCTGGGTGGG + Intergenic
1118776765 14:68978535-68978557 TATGGAGAGGTGGCCAGGGGCGG + Intronic
1119205118 14:72788354-72788376 TGTGGGGAGGAGGGCCGGGCAGG + Intronic
1119257156 14:73208557-73208579 AGTGGAGAGGAGACCCGGAGTGG + Intronic
1119889828 14:78174435-78174457 TGTAGAGAGGAGAACTGGGTCGG - Intergenic
1120315755 14:82890575-82890597 TATATAGAGGAGGCCAGGCGTGG - Intergenic
1120426808 14:84358924-84358946 TGTATAGAGGTGCCCCGGGGTGG + Intergenic
1120878127 14:89393229-89393251 AGAAGAGAGGAGGCCAGGTGGGG - Intronic
1121531968 14:94661008-94661030 TGGAGAGAGGATGCTCTGGGTGG + Intergenic
1121948512 14:98147186-98147208 TTTAAAGAGGAGGCTGGGGGAGG - Intergenic
1122111798 14:99508523-99508545 TGAAGAGAGCAGGGCCTGGGAGG + Exonic
1122139595 14:99654561-99654583 AGTAGAGAGGAGGTAGGGGGAGG + Intronic
1122318231 14:100838027-100838049 TGTGGAGAAGAGGCCCGGGAGGG + Intergenic
1122409224 14:101517607-101517629 TGAAGAGAGGAGGCCTGAGCAGG - Intergenic
1122660888 14:103293994-103294016 TGGAGAGGGAAGACCCGGGGTGG - Intergenic
1122686801 14:103512440-103512462 TTTAGGGAGGAGGCCGGGTGTGG - Intergenic
1122801067 14:104229727-104229749 TGTAAATAACAGGCCCGGGGTGG - Intergenic
1123018203 14:105385463-105385485 TGCAGGGAGGAGGCGCCGGGCGG - Intronic
1123434964 15:20247972-20247994 TGGAGAGAGGAGAGCAGGGGAGG + Intergenic
1124220153 15:27844204-27844226 TGCAGAGATGAGGCCCTCGGTGG - Intronic
1125907813 15:43409567-43409589 TGTTGAGAAGAGGCCTGGGAGGG - Intronic
1126156845 15:45573956-45573978 AGCAGAGAGGAGGCCTGGAGTGG + Intergenic
1127525896 15:59791924-59791946 AGCAGAGAGGAGGCCTGGAGTGG + Intergenic
1127600260 15:60528439-60528461 TGTAGAGATGAGGCCTGTGTAGG - Intronic
1127843827 15:62852275-62852297 TGTAAAGAGGTGGCCCGGGGTGG - Intergenic
1128273398 15:66332167-66332189 TGAAGATTGGAGGCCAGGGGTGG + Intronic
1129194628 15:73956556-73956578 TGCAGAGAGGAGGCTCAGGTGGG - Intergenic
1129252844 15:74318366-74318388 TGGAGACAGCAGGGCCGGGGAGG - Intronic
1130676094 15:85953302-85953324 TGCAGAGAGGAGGCCAGGCATGG - Intergenic
1131439533 15:92448462-92448484 TGTAGAGAGGAAGGCTGAGGAGG + Intronic
1132326227 15:100973026-100973048 TCTAGAGTGGAAGCTCGGGGAGG + Intronic
1132349844 15:101132919-101132941 TGTGGAGTGGAGGCCTGTGGGGG - Intergenic
1132595593 16:747795-747817 TGTGGAGATGAGGCCCGAGGTGG + Intronic
1132606232 16:794894-794916 TGTAGCGAGGATGCTCAGGGTGG + Intronic
1132647710 16:1006797-1006819 TGTGGACAGGAGGGACGGGGTGG - Intergenic
1134157332 16:11854052-11854074 TGTAGAGATGAGGACAGGGAGGG + Intergenic
1134841426 16:17405069-17405091 TGTAGAGAGGTGGCGCGGGGTGG - Intronic
1135547537 16:23376006-23376028 TGCAGAAAGGAGGCCTGGGAGGG - Intronic
1136457344 16:30388262-30388284 TGTAGAGAACAGGCCTGGCGTGG - Intronic
1137617014 16:49854695-49854717 CGGGGAGAGGAGGCCAGGGGAGG + Intronic
1138554225 16:57762674-57762696 GGTAGAGAGGAGGCACAAGGAGG + Intronic
1140037281 16:71380967-71380989 TGGGGAGAGGAGGCACGTGGGGG + Intronic
1140218279 16:73025317-73025339 TTAAGAGAGGGGGCCCGGGAAGG + Intronic
1141012462 16:80415717-80415739 TGCAGAGAGGAGGCATGGGTGGG - Intergenic
1141690365 16:85593281-85593303 TGTGGAGGGGAGGGGCGGGGTGG - Intergenic
1141703806 16:85654019-85654041 TGGACTGAGGAGGCCCAGGGAGG + Intronic
1142308343 16:89298243-89298265 TGTGGAAAGGAGGCCCAGGGTGG - Intronic
1142377303 16:89712509-89712531 TGTAGAGAGAGGGTCTGGGGGGG + Exonic
1142425013 16:89997528-89997550 TGTCCTGAGGAGGCCCGGGAAGG - Intergenic
1143864438 17:9913656-9913678 GGTAGAAAGGAGGCCCAGGGTGG + Intronic
1143957154 17:10679947-10679969 TGTAGAGATGGGGGCGGGGGGGG + Exonic
1144618685 17:16800604-16800626 TGTAGAGATGGGGCCCAGGCTGG - Intronic
1144894020 17:18515091-18515113 TGTAGAGATGGGGCCCAGGCTGG + Intergenic
1145138211 17:20429170-20429192 TGTAGAGATGGGGCCCAGGCTGG - Intergenic
1145935327 17:28711667-28711689 TGTAGAGACGAAGACCTGGGCGG - Exonic
1146185911 17:30724092-30724114 TCTAGAGAAGAGGCCCTGTGAGG + Intergenic
1148001279 17:44388953-44388975 TGCAGAGAGGAGGCCGGGCGCGG - Intronic
1148262149 17:46193229-46193251 TGGAAAGAGGCGGCCGGGGGTGG - Intronic
1148444021 17:47726973-47726995 GGGAGAGAGGAGGCCCCAGGGGG + Intergenic
1148455779 17:47810743-47810765 AGTAGAGGGCAGGGCCGGGGTGG - Intronic
1150230241 17:63545744-63545766 TGTAGAGGTGAGGCTAGGGGTGG - Exonic
1151873291 17:76850968-76850990 TGCAGAGAGGAGGGGCGGGGTGG + Intergenic
1152228032 17:79101746-79101768 TGGAGAGAGGAGGCTGGGGCGGG - Intronic
1152663861 17:81556024-81556046 TGAGGTGAGGAGGCTCGGGGAGG - Intergenic
1152820517 17:82435567-82435589 TGTGGGGAGGAGGCCAGGGAGGG - Intronic
1153765680 18:8372362-8372384 TATAGAGTGGAGGCCGGGCGCGG - Intronic
1154281313 18:13005572-13005594 GGAAGACAGGAGGCCTGGGGAGG + Intronic
1154313703 18:13286828-13286850 TGTGGAGAAGAGGCCTGGGGTGG + Intronic
1155932047 18:31718675-31718697 AGTGGAGAGGAGGCAGGGGGTGG - Intergenic
1160083547 18:75753621-75753643 AGCAGAGAGGAGACCCGGAGTGG + Intergenic
1160703146 19:517831-517853 TGGGGAGGGGAGGCCCGGGCTGG + Intronic
1160793547 19:933677-933699 TGGAGTCAGGAGCCCCGGGGAGG - Intronic
1160841274 19:1147948-1147970 TGGAGAGAGGCGCCCCTGGGCGG - Intronic
1161103007 19:2430593-2430615 TGGAGGGAGGAGGGCCGGCGAGG - Exonic
1161118358 19:2511887-2511909 TGGAGAGAGGAGGGCAGGGGAGG + Exonic
1161249042 19:3270724-3270746 TTTAGAGTGGAGGCCTGGAGAGG + Intronic
1161686703 19:5706316-5706338 TGTAGAGATGGGGCCAGGCGCGG + Intronic
1161719212 19:5894019-5894041 TCTGGAGAAGGGGCCCGGGGTGG + Intronic
1162113968 19:8417151-8417173 TGTAAAGACCAGGCCAGGGGTGG + Intronic
1162796432 19:13089831-13089853 TGAAGAGAGGGGGCCAGGGGAGG - Intronic
1162972865 19:14191637-14191659 TCTAGAGAAGAGGCCCTGTGAGG - Intronic
1163258640 19:16173244-16173266 TGGAGGGAGGAGGCCGTGGGAGG - Intronic
1163307064 19:16487186-16487208 TGTAGAGATGGGGCCAGGCGTGG + Intronic
1163535781 19:17875589-17875611 TGTAGAGATGGGGGCGGGGGGGG - Intronic
1163779657 19:19239725-19239747 AGAAGGGAGGAGGCCTGGGGAGG - Intronic
1164031530 19:21411078-21411100 CGTAGACATGAGGCCAGGGGTGG - Intronic
1164578594 19:29420601-29420623 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578605 19:29420650-29420672 GGTGGAGACGAGGCCGGGGGAGG - Intergenic
1164578623 19:29420748-29420770 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578634 19:29420797-29420819 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578644 19:29420834-29420856 GGTGGAGAGGAGGCTGGGGGAGG - Intergenic
1164578655 19:29420883-29420905 GGTGGAGATGAGGCCGGGGGAGG - Intergenic
1164578665 19:29420932-29420954 GGTGGAGAGGAGGCCGGGGAAGG - Intergenic
1164578675 19:29420981-29421003 GGTGGAGACGAGGCCGGGGGAGG - Intergenic
1164578685 19:29421030-29421052 GGTGGAGACGAGGCCGGGGGAGG - Intergenic
1164587319 19:29484151-29484173 TGCAGAGAGGAGGTGTGGGGAGG + Intergenic
1164615419 19:29664545-29664567 TGTGGGGAGGAGGCCAGGGAGGG + Intergenic
1165391941 19:35543836-35543858 TGAGGAGAGGAGACCCTGGGAGG + Intronic
1165777301 19:38412410-38412432 TCTAGATAGGAGGCCAGGAGTGG - Intronic
1165778782 19:38420281-38420303 TGGTGAGATGAGGCCGGGGGTGG + Intronic
1166130688 19:40744030-40744052 GGGAGAGAGGAGGGCAGGGGTGG - Intronic
1166558116 19:43715077-43715099 GGCAGAGAGGAAGCCCGGAGGGG + Intergenic
1166837886 19:45678259-45678281 TCTGGGGAGGAGGCCCTGGGTGG - Intronic
1167158730 19:47754660-47754682 GGTGGGTAGGAGGCCCGGGGAGG - Intronic
1167223103 19:48216491-48216513 TGTGGAGATGAGGCCTGGGTCGG + Intronic
1167346280 19:48947380-48947402 AGTAGAGAGGAGCCCTGGAGAGG - Intergenic
1167699413 19:51033773-51033795 TGTTGGGTGGAGGGCCGGGGAGG - Intronic
1168303462 19:55420039-55420061 AGCAGAGAGGAGGCCCTGGTGGG - Intergenic
1168340842 19:55622200-55622222 TGCAGAACAGAGGCCCGGGGTGG - Exonic
1168495069 19:56840811-56840833 TGTGGTGAGGGGGCCCGGAGAGG - Intergenic
1168659848 19:58157295-58157317 TGGAGGGAGGAGGCGCGGGCGGG + Intergenic
925404729 2:3598687-3598709 TGTGGAGAGGAGGCTGGAGGCGG + Intronic
925404741 2:3598725-3598747 TGTGGAGAGGAGGCTGGAGGCGG + Intronic
928383117 2:30838362-30838384 TGTGGAGAGGTGGGCTGGGGAGG + Intergenic
929659956 2:43774195-43774217 TGGAGAGAGGAAGCCCAGGCGGG + Intronic
930171506 2:48256127-48256149 TGTAGGGAGGAGGCTAGGAGAGG + Intergenic
931971798 2:67594890-67594912 TGTAGGGTGGAGGCAGGGGGAGG + Intergenic
932281594 2:70497626-70497648 TGTAGAAAGGAGGGCCAGGCTGG + Intronic
932422272 2:71608249-71608271 TGCAGAGAGGAGGGCGCGGGTGG + Intronic
933624668 2:84585595-84585617 AGCAGAGAGGAGGCCTGGAGAGG + Intronic
934744943 2:96753221-96753243 TGTAGAGATGGGGGCGGGGGCGG + Intergenic
934763971 2:96870130-96870152 GGTCGAGCGGAGGCCGGGGGCGG + Intronic
935043602 2:99458916-99458938 TGTAGTGTGGAGGCCGGGCGCGG + Intronic
935755530 2:106273538-106273560 GGTGGTGAGGAGGCCTGGGGTGG - Intergenic
937974851 2:127576490-127576512 TGTGGAGCGGAGGCCAGGGCTGG + Intronic
938169199 2:129059764-129059786 TGGAGAGAGCAGCCCTGGGGTGG - Intergenic
940911879 2:159216499-159216521 TCTAGAGAGGAGGACGGAGGAGG - Intronic
942073829 2:172338910-172338932 TGAAGAAATGAGGCCCAGGGAGG + Intergenic
944531342 2:200670468-200670490 AGTATAGAGGAAGCCAGGGGAGG - Intronic
944743324 2:202633492-202633514 CCTAGAGAGGAGGCCGGGTGTGG - Intergenic
946412035 2:219520283-219520305 AGGAGAGAGGAGGGCAGGGGAGG - Intronic
947718496 2:232353395-232353417 TGGAGAGAGAAGGCCCAGGAGGG + Intergenic
947729972 2:232422319-232422341 TGGAGAGAGAAGGCCCGAGGGGG + Intergenic
1169038272 20:2471057-2471079 TGTAGAGGAGAGAGCCGGGGAGG - Intronic
1169250649 20:4058290-4058312 TGTAGAGAGGTGGGCGGGGGGGG + Intergenic
1169268599 20:4182365-4182387 GGTGGAGAGGAGCCCCGGGGGGG + Exonic
1170775451 20:19371316-19371338 TGGAGAGGGCAGGCCCTGGGAGG + Intronic
1172009755 20:31839744-31839766 TGTAGAGAGGCAGCCAGTGGGGG + Intergenic
1172264186 20:33596713-33596735 TGTGGAGCTGAGGCCTGGGGTGG - Intronic
1172803731 20:37596666-37596688 TGTGGAGATGGGGCACGGGGTGG - Intergenic
1172901216 20:38336267-38336289 GGAAGAGAAGAGGCCTGGGGAGG - Intronic
1173203133 20:40968867-40968889 TGCAGCGAGGAGGGCCGTGGGGG - Intergenic
1173824892 20:46041911-46041933 TGCACAGAGAATGCCCGGGGGGG + Intronic
1174169254 20:48605980-48606002 TGAGGAGAGAAGGCCCTGGGAGG - Intergenic
1175427365 20:58877165-58877187 TTTACAGAGGAGGCTCGTGGTGG + Intronic
1175492279 20:59387242-59387264 CCTAGAGAGGAGGCTCGGGGGGG + Intergenic
1175694457 20:61090986-61091008 TGTAGAGAGGGGGCCAGTGGGGG - Intergenic
1175993525 20:62801811-62801833 TCCAGAAGGGAGGCCCGGGGCGG - Intergenic
1177291664 21:19120823-19120845 TGTAGAGGAGAGGTCCCGGGGGG - Intergenic
1178138569 21:29656071-29656093 TGAAGAGAGAAGGCCGGGTGCGG + Intronic
1178244427 21:30936925-30936947 AGCAGAGAGGAGGCCTGGAGTGG - Intergenic
1178411271 21:32365661-32365683 AGTAGAGAGGAGGCCTGTGTGGG - Intronic
1178484516 21:33010102-33010124 TAAAGAAAGGAGGCCAGGGGGGG + Intergenic
1179171121 21:38973619-38973641 TGGAGAAAGGAGGCCCTGGCAGG + Intergenic
1180170540 21:46055939-46055961 TGCAGAGAGGAGGCCCCCGGAGG - Intergenic
1180609397 22:17085599-17085621 TGTGGAGAAGGGGCCCGGGGAGG + Intronic
1180665349 22:17506415-17506437 AGTAGAGAGGGGGCCAGGTGTGG - Intronic
1183329679 22:37212536-37212558 TTAAGGGAGGAGGCCCGGAGAGG + Intergenic
1184457138 22:44617034-44617056 TGTGGAGAGGGGCCCCGGGTTGG - Intergenic
1184973768 22:48046489-48046511 TGCAGAGCGGAGGCCAGGAGAGG - Intergenic
1185345673 22:50309545-50309567 TGTGCAGAAGAGGCCTGGGGTGG - Exonic
1203296224 22_KI270736v1_random:45301-45323 TGTGGTGGGGAGGCCGGGGGAGG - Intergenic
949790476 3:7786792-7786814 TAGAGAGAGGAGGCATGGGGTGG - Intergenic
949961293 3:9314647-9314669 TGGAGAGAGGAGGGCAGGGTGGG - Intronic
952195159 3:31067824-31067846 TGTAGAGAGAATTCTCGGGGTGG + Intergenic
952341643 3:32452212-32452234 TGCAGAGAGGAAGCCCCGCGAGG - Intronic
952657332 3:35801887-35801909 AGTGGAGAGGAGACCCGGAGTGG + Intergenic
954183328 3:48898644-48898666 TTTGGGGAGGAGGCCCGGGCGGG - Intronic
954635032 3:52066559-52066581 TGGAGAGGGGAGGCCAGTGGTGG - Intergenic
956381895 3:68673035-68673057 TGTAGAGAAGAGGCCAGGAGAGG + Intergenic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
958141773 3:89571244-89571266 AGCAGAGAGGAGACCCGGAGTGG + Intergenic
958195361 3:90236025-90236047 AGTAGAGAGGAGGCCTAGAGTGG - Intergenic
958418774 3:93907420-93907442 AGTAGAGAGGAGGCCTAGAGTGG - Intronic
958636298 3:96750876-96750898 AGCAGAGAGGAGGCCTGGAGAGG - Intergenic
958678088 3:97292762-97292784 AGTGGAGAGGAGACCCGTGGTGG + Intronic
958678098 3:97292831-97292853 AGCAGAGAGGAGACCCGTGGTGG + Intronic
959087245 3:101864466-101864488 TACAGAGAGGAGGCACAGGGAGG - Intergenic
959703055 3:109316270-109316292 TGTAGAGAGGAGACCTGGGATGG + Exonic
961091175 3:124114007-124114029 GGTAGAGAGTAGGCCCTGGGTGG + Intronic
961493650 3:127274936-127274958 AGCAGAGAGGAGGCCTGGAGTGG - Intergenic
961592286 3:127990095-127990117 TGCAGAGAGGAGCCCAGGGAGGG + Intergenic
961736158 3:129003378-129003400 TCTAGTGAGCAGGCACGGGGAGG + Intronic
961791115 3:129377671-129377693 AGCAGAGAGGAGGCCCTGGGAGG + Intergenic
962139353 3:132772215-132772237 TGTAGATCTGAGGCCCAGGGAGG - Intergenic
963084749 3:141426517-141426539 GGAGGAGAGGAGGCCGGGGGAGG + Intronic
964285088 3:155109195-155109217 TTGAGAGAGGAGGCCATGGGGGG + Intronic
964722798 3:159783969-159783991 TTTAGAAAGAAGCCCCGGGGTGG - Intronic
964927804 3:161978777-161978799 AGCAGAGAGGAGACCCGGAGTGG + Intergenic
965602789 3:170471388-170471410 TGTAGAGAAGGGGTCAGGGGAGG - Intronic
966256176 3:177918355-177918377 AGCAGAGAGGAGGCCTGGAGTGG - Intergenic
967118180 3:186360889-186360911 TGTGGGGAGGAGGGCCTGGGAGG - Intronic
967812899 3:193775404-193775426 TGGAGAGAAGAGGCCAGAGGAGG + Intergenic
967963286 3:194941953-194941975 GGTGGAGAGGAGGCCTGGAGGGG - Intergenic
968036133 3:195549623-195549645 TGAAAAGAGGAGGCCAGGCGTGG - Intergenic
968812582 4:2806656-2806678 TGGAGGGAGGAGGCCAGGGCGGG - Intronic
968816844 4:2825970-2825992 TGGGGACAGGAGGCCCAGGGAGG + Intronic
969361114 4:6664326-6664348 GGCAGGGAGGAGGCCCGCGGAGG - Intergenic
969453058 4:7285942-7285964 TGTAGCGTGGAGGCCCAGTGCGG + Intronic
969476474 4:7425092-7425114 TGGAGAGAGCAGGACAGGGGAGG - Intronic
969842082 4:9890097-9890119 TTTAGAGATGAGGCCCGGAGAGG + Intronic
971618802 4:28828284-28828306 GGGAGAGAGGAGCCGCGGGGAGG - Intergenic
972358662 4:38305875-38305897 TGTGCAGAAGAGGCCAGGGGTGG - Intergenic
974235848 4:59180093-59180115 AGTGGAGAGGTGACCCGGGGTGG - Intergenic
975372808 4:73607892-73607914 AGTAGAGAGGAGGGGAGGGGAGG - Intronic
975372827 4:73607960-73607982 AGTAGAGAGGAGGGGAGGGGAGG - Intronic
978751698 4:112255919-112255941 TGTAGAAAGTAGACCCAGGGAGG - Intronic
979590983 4:122480123-122480145 TCTATAGAGGATGCCCAGGGAGG - Intergenic
979649451 4:123113907-123113929 AGCAGAGAGGAGGCCTGGAGTGG + Intronic
982136641 4:152279287-152279309 GGAAGGGAGGAGGCCCTGGGTGG - Intergenic
983290025 4:165790244-165790266 TGTAGGGAGGAGGCAAGGGGTGG - Intergenic
983550464 4:169012109-169012131 TGTAGAGATGGGGGTCGGGGGGG - Intergenic
984037218 4:174684666-174684688 TAGAGAGAGGAGGCACGGTGTGG + Intronic
985306971 4:188554220-188554242 GGCAGAGAGGAGGCACGTGGAGG + Intergenic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986337708 5:6767569-6767591 TGGAGAGAGAGGGCCCGGAGTGG - Intergenic
987112455 5:14700661-14700683 TGCAGAGGGGAGGGCTGGGGAGG - Intergenic
987245834 5:16047837-16047859 TGCAGAGAAGAGGCCCAGGTAGG + Intergenic
990023779 5:51160273-51160295 AGCAGAGAGGAGGCCTGGAGTGG - Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
994001996 5:94791807-94791829 TCTGGAGAGGAGGACCAGGGTGG - Intronic
994916252 5:105983059-105983081 TGCAGAGAGGAGACCCAGAGTGG - Intergenic
996294091 5:121890836-121890858 AGTAGAGAGGGGACCTGGGGAGG + Intergenic
997282395 5:132656987-132657009 GGCAGAGAGGGGGCCTGGGGAGG + Intronic
999100836 5:149024747-149024769 GGTGGAGAGGAGGTCAGGGGTGG - Intronic
999157572 5:149469437-149469459 TGTAAAGAGGGGGCCAGGCGCGG + Intergenic
1000616948 5:163437747-163437769 TGAGGTGAGCAGGCCCGGGGAGG + Exonic
1002160478 5:177311613-177311635 ACTCGAGAGGAGTCCCGGGGCGG - Intronic
1005626810 6:27670056-27670078 GGCAGAGAAGAGGCCCGTGGCGG + Intergenic
1006470083 6:34223818-34223840 TCTTGAGAGGAGGCCAGGGGAGG - Intergenic
1006500976 6:34458542-34458564 AGCAGAGAGGAGGCCCTGGAGGG - Intergenic
1006614983 6:35320011-35320033 TGTGGAGGTGAGGCCTGGGGTGG + Exonic
1008521131 6:52362754-52362776 GGAGGAGAGGAAGCCCGGGGCGG + Intronic
1012349146 6:98229923-98229945 TGTAAAGATGAGGCCCAGAGAGG - Intergenic
1012474631 6:99605861-99605883 TGTAGAGAAGAGGGGCGAGGTGG - Intergenic
1012503422 6:99916252-99916274 TGAGGAGAGGAGGCCCGGCGTGG + Intergenic
1013236009 6:108198495-108198517 AGCAGAGAGGAGGCCCTGGAGGG + Intergenic
1013405305 6:109837947-109837969 TGGCGAGAGGAGTCCCGTGGGGG + Intergenic
1015194031 6:130505618-130505640 AGTAGGGAGGAGGGCTGGGGTGG + Intergenic
1016339642 6:143049342-143049364 AGCAGAGAGGAGGCCCTGAGAGG + Intergenic
1016936015 6:149450142-149450164 TGTAGTCAGGTGGCCAGGGGAGG - Intronic
1017888446 6:158620201-158620223 TGGTGAGAGGAGGCCCGGGGGGG + Intronic
1018062487 6:160101949-160101971 TGGAGAGAGGAGACCCGTCGGGG + Intronic
1018890227 6:167977371-167977393 AGGGGAGAGGAGGCCCCGGGTGG - Intergenic
1019294077 7:264750-264772 TGACGAGAGGAGCCCCGAGGGGG + Intergenic
1019629922 7:2043615-2043637 TGCAGAGTGGAGGCACGCGGAGG + Intronic
1019705628 7:2495954-2495976 TGCAGAGAGGAGGCCCTGTGGGG + Intergenic
1019897881 7:3997381-3997403 AGCAGAGAGGAGGCCTGGAGTGG + Intronic
1020404469 7:7816449-7816471 TGTAGAGATGAGGCCGGGAGAGG + Intronic
1020511508 7:9062677-9062699 TGGAGAGAGGAGGGGAGGGGCGG - Intergenic
1022021950 7:26408518-26408540 TATAGAGAAGAGGCCGGGTGCGG + Intergenic
1026334890 7:69385429-69385451 TGTTGAGAGGGGGCAGGGGGAGG + Intergenic
1028233364 7:88330850-88330872 TGCAGAGAGGTGGCCCTGGAGGG - Intergenic
1029375040 7:100172048-100172070 GGTGGAGGTGAGGCCCGGGGCGG - Intronic
1030243846 7:107359864-107359886 AGTAGAGAGGAGACCTGGAGTGG - Intronic
1034481047 7:151320739-151320761 TGCTCAGAGGAGGCCCAGGGTGG - Intergenic
1035476849 7:159149861-159149883 TTGAGAGATGAGGCCCGGGTGGG + Intergenic
1035601694 8:900714-900736 TGTAGAGAGAAATTCCGGGGAGG + Intergenic
1038491652 8:27976131-27976153 TGGAGAGAGGAAGCTGGGGGAGG + Intronic
1038513316 8:28161281-28161303 AGTAGAGAGGTGGCCGGGAGTGG + Intronic
1040372923 8:46794860-46794882 TGAAGTGAGGAGGCCCAGGTGGG - Intergenic
1043395022 8:79827620-79827642 TGCAGAGGGGAGGCCGGCGGTGG - Intergenic
1044593929 8:93940583-93940605 TGGAGAGGGGATGCGCGGGGTGG + Intergenic
1049073369 8:140374267-140374289 TGTAAAGAGGAGGCAGGGGTTGG + Intronic
1049373858 8:142279939-142279961 TGTGAGGAGGAGGCCGGGGGCGG + Intronic
1049456098 8:142690110-142690132 TGTGGAGGGGAGGCGGGGGGTGG + Intergenic
1049824060 8:144655571-144655593 AGCAGAGAGGAGGCCTGGAGTGG - Intergenic
1049938090 9:518614-518636 TGTAAAGAGGAGGAGCTGGGAGG + Intronic
1055427999 9:76215629-76215651 TGGAGAGTGGAGGCCAGGTGTGG + Intronic
1055924333 9:81494414-81494436 TGTGGAGAGGCTACCCGGGGAGG - Intergenic
1059655919 9:116357502-116357524 TGCAGAAAGAAGGCCCGGGGAGG + Intronic
1060149873 9:121281767-121281789 TGTAGGGAGGAGGCCGGGACTGG + Intronic
1060585342 9:124782129-124782151 TGTAGAGAGGGGGCCCTGGGGGG - Intronic
1060946854 9:127574798-127574820 TAAAGAGAGGAGGTCCGGGCTGG - Intronic
1061088680 9:128414018-128414040 GGTAGAGCAAAGGCCCGGGGTGG - Intronic
1061995012 9:134178795-134178817 TGCAGAGAGGAGGGCCTGGCTGG - Intergenic
1062191748 9:135251457-135251479 TGGAGTGAGGAGGCCCTGTGGGG - Intergenic
1062321041 9:135990727-135990749 TGGAGAGGGGAGGGCTGGGGAGG - Intergenic
1062395116 9:136349688-136349710 CGCTGAGAGGAGGCCCCGGGAGG + Exonic
1062432754 9:136533242-136533264 TGGAGAGTGGAGGCCCAAGGGGG + Intronic
1062581449 9:137230892-137230914 TGCAGGGAGGAGACACGGGGCGG - Exonic
1062628279 9:137452706-137452728 TGTTGGGGGCAGGCCCGGGGCGG + Intronic
1062645348 9:137545091-137545113 TGCAGGGAGGCGGCCAGGGGAGG + Intronic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1188647908 X:32592452-32592474 AGTAGAGAGGAGACCCATGGTGG - Intronic
1190263988 X:48816651-48816673 TGGGGAGAGGAGGACCTGGGGGG + Intronic
1192195652 X:69026102-69026124 TGTAGAGAAGGGCCCCAGGGTGG + Intergenic
1192458371 X:71296503-71296525 TGTAGAGAAGAAGCCTGGTGGGG + Intronic
1195029246 X:100910293-100910315 TTAAGAGAGTAGGCCAGGGGTGG + Intergenic
1195959020 X:110366046-110366068 AATAGAGAGATGGCCCGGGGAGG + Intronic
1196288853 X:113915415-113915437 TGGAGAGGGGAGGGCAGGGGAGG - Intergenic
1198341722 X:135720526-135720548 TGTAGAGAGGAGGCTGGTTGAGG + Intronic
1198350084 X:135797383-135797405 TGTAGAGAGGAGGCTGGTTGAGG - Intronic
1198351994 X:135814656-135814678 TGTAGAGAGGAGGCTGGTTGAGG - Intronic
1198355810 X:135849174-135849196 TGTAGAGAGGAGGCTGGTTGAGG - Intronic
1198357721 X:135866453-135866475 TGTAGAGAGGAGGCTGGTTGAGG - Intergenic
1199951152 X:152707032-152707054 TGTAGGCAGGAGGCCCAGGAAGG + Intergenic
1199955892 X:152742199-152742221 TGTAGGCAGGAGGCCCAGGAAGG - Intergenic
1199958530 X:152761429-152761451 TGTAGGCAGGAGGCCCAGGAAGG - Intergenic
1200213266 X:154356302-154356324 TGGAGACAGGGAGCCCGGGGTGG - Intronic
1200814961 Y:7521911-7521933 TGTAGAGAGAGGGCCCTGGAGGG + Intergenic
1202191066 Y:22245398-22245420 AGCAGAGAGGAGGCCCTGGAGGG - Intergenic