ID: 912568554

View in Genome Browser
Species Human (GRCh38)
Location 1:110606216-110606238
Sequence GGATGAACTTACTCTCCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912568550_912568554 11 Left 912568550 1:110606182-110606204 CCCCACACAACAAAGTCTGCACT No data
Right 912568554 1:110606216-110606238 GGATGAACTTACTCTCCCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 94
912568552_912568554 9 Left 912568552 1:110606184-110606206 CCACACAACAAAGTCTGCACTGT No data
Right 912568554 1:110606216-110606238 GGATGAACTTACTCTCCCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 94
912568551_912568554 10 Left 912568551 1:110606183-110606205 CCCACACAACAAAGTCTGCACTG No data
Right 912568554 1:110606216-110606238 GGATGAACTTACTCTCCCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912568554 Original CRISPR GGATGAACTTACTCTCCCTC CGG Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900875203 1:5337609-5337631 GGATGAATTTGCTCTCCTCCGGG - Intergenic
901622960 1:10603944-10603966 GGAATAACTCACTCTCTCTCAGG - Intronic
903480713 1:23651349-23651371 AGATGAACTCACTTGCCCTCGGG - Intergenic
903704026 1:25271817-25271839 GGGTGAAGTTGCTCTACCTCTGG - Intronic
903723210 1:25421495-25421517 GGGTGAAGTTGCTCTACCTCTGG + Intronic
912568554 1:110606216-110606238 GGATGAACTTACTCTCCCTCCGG + Intronic
913285810 1:117225362-117225384 GGTTGTGCTTTCTCTCCCTCTGG + Intergenic
916771127 1:167909712-167909734 GTACCAACTTACACTCCCTCAGG + Intronic
1065152489 10:22836423-22836445 GGCTGAACATCCTCTCACTCGGG + Intergenic
1065723754 10:28650636-28650658 GAATGAATTTTCACTCCCTCAGG + Intergenic
1065875676 10:29995476-29995498 GGCTTAACTGACTCTCCCTCAGG - Intergenic
1067557997 10:47285646-47285668 GGATCAAGTTTGTCTCCCTCAGG - Intergenic
1069621006 10:69837172-69837194 CAAAGAACTTACTTTCCCTCGGG + Intronic
1069680098 10:70278093-70278115 GGAAGAACTTTCTATCACTCAGG - Intronic
1071365036 10:84890866-84890888 GACTGAACATACTCTGCCTCTGG + Intergenic
1075569336 10:123528138-123528160 AGAAGAACTAAATCTCCCTCAGG + Intergenic
1081755389 11:45540712-45540734 GAATGTACTTCCTCTCCCACAGG - Intergenic
1084701335 11:70788110-70788132 GGATCCACCTGCTCTCCCTCGGG - Intronic
1084757232 11:71247650-71247672 AGCTGATCTTCCTCTCCCTCTGG + Intronic
1086798950 11:91146607-91146629 GGATGAACTTATATTCCATCAGG - Intergenic
1088894663 11:114068698-114068720 AGATGATCTTCCCCTCCCTCAGG - Intronic
1089289487 11:117429002-117429024 GGATGATCTTACTTCCCCACAGG + Intronic
1092750287 12:11712629-11712651 GGCTGAACTTCCTCTTCCTTGGG + Intronic
1096616806 12:52837840-52837862 GGATGAATTTAGTTTCCTTCTGG + Intronic
1097002766 12:55891977-55891999 GGACGAACTTAGTCTCCACCAGG + Intergenic
1098875604 12:75863737-75863759 GAATGAATTGACTCTCCCTCTGG - Intergenic
1113550423 13:111188852-111188874 GGATGCATTTCCTCTCCTTCAGG + Intronic
1116065078 14:39972043-39972065 GGATCATCTTACTCTGCCTATGG + Intergenic
1116826357 14:49677054-49677076 GGCTGAACCCACTCTCCCCCAGG - Intronic
1119322836 14:73741761-73741783 GGAGGAAATTACTCCCCTTCTGG - Intronic
1125634029 15:41172212-41172234 GGCTGAAGTTACTGGCCCTCTGG + Intergenic
1125788540 15:42344280-42344302 GCATGAACAGATTCTCCCTCAGG - Intronic
1126547374 15:49887962-49887984 GGATGAACTTACTACCTCTTTGG + Intronic
1128564896 15:68694700-68694722 GGGTGTACCTACTCTCCCTGGGG - Intronic
1129499438 15:76021927-76021949 GGTTGAAATTATTCTACCTCAGG + Intronic
1129590015 15:76906525-76906547 GTATGAACCTACTCTGGCTCAGG + Intergenic
1131569501 15:93520324-93520346 GGCTGAAGTTCCTCTCTCTCTGG - Intergenic
1132120914 15:99174628-99174650 GGATGAACTTACACGGCTTCAGG - Intronic
1139518059 16:67463637-67463659 GGATGGATTAACTCTACCTCTGG - Intronic
1141969945 16:87474397-87474419 GGAAGAATTCACTCTCCCTGAGG - Intronic
1161325597 19:3662186-3662208 GGATGAAGCCACCCTCCCTCGGG + Intronic
1168260016 19:55188037-55188059 GGCTGAGCTCAGTCTCCCTCCGG - Intronic
925428492 2:3771111-3771133 GGATGACCTAGCTCACCCTCAGG - Intronic
935047382 2:99494273-99494295 AGATGATCTTTCTCTCACTCTGG - Intergenic
935563512 2:104583021-104583043 GGATGAAGTTGCTGTGCCTCAGG + Intergenic
936377333 2:111953138-111953160 TGATGAATTCACTCTCCATCAGG + Intronic
938660732 2:133484367-133484389 GGAAGAACTTACTCACTATCGGG - Intronic
940207165 2:151215944-151215966 TGAAGAATTAACTCTCCCTCTGG - Intergenic
942698654 2:178677713-178677735 GGAGGAACTTCCTCTTCCTCAGG + Exonic
942698662 2:178677776-178677798 GGTAGAACTTCCTCTTCCTCAGG + Exonic
942698665 2:178677797-178677819 GGTAGAACTTCCTCTTCCTCAGG + Exonic
948118341 2:235510637-235510659 GGTTGATTTTACTCTCCCGCCGG + Intronic
1169285677 20:4305295-4305317 GGATGAGCTTCCTCACCCTCGGG + Intergenic
1171996744 20:31737381-31737403 GGATGAAATTACTCTGGCACTGG - Intergenic
1173168933 20:40706718-40706740 GGCTGATCTTGCTTTCCCTCTGG + Intergenic
1178192780 21:30304962-30304984 GTATAACTTTACTCTCCCTCTGG + Intergenic
1179855276 21:44159907-44159929 GGAGGAAGTCAGTCTCCCTCGGG + Intergenic
1182833756 22:33324690-33324712 GGATGCACTTGTACTCCCTCTGG - Intronic
949108532 3:229887-229909 AGATAAAATTTCTCTCCCTCCGG + Intronic
952854005 3:37752619-37752641 GGATGGGCTTACTCGCCCTATGG + Intronic
953414101 3:42705680-42705702 GGATGACCTCCCTGTCCCTCAGG - Intronic
953515097 3:43582784-43582806 GGTTGAAGTTACTCAGCCTCTGG + Intronic
953667978 3:44939817-44939839 GGCTGTACTCACTCTCCCTGCGG - Intronic
956898874 3:73692980-73693002 GAATTAACTTCCTCACCCTCAGG + Intergenic
965083282 3:164063616-164063638 TGATTAAGTTACTCTCCCACTGG - Intergenic
969562201 4:7956485-7956507 GGAGGGACTGACTCACCCTCCGG + Intergenic
974443785 4:61952551-61952573 GCATGAATTTGTTCTCCCTCTGG - Intronic
975202568 4:71608566-71608588 GAAAGAACTTACTCACCCTGAGG - Intergenic
976373375 4:84315951-84315973 GGATGAACACACTCTGCCTCAGG + Intergenic
981836681 4:149063591-149063613 GCATGAACTGATACTCCCTCAGG - Intergenic
984297180 4:177866985-177867007 GGCTGAACTAAGTCTCCATCAGG + Intronic
987145936 5:14991803-14991825 GGAGGAATTTTCTCTTCCTCAGG - Intergenic
987853319 5:23385365-23385387 GTATGAACCTACTCTGCTTCAGG + Intergenic
997923816 5:138009441-138009463 GGATGTACTTAATATCCATCTGG + Intronic
998792449 5:145779768-145779790 GGATGAACTTAACCTCTCTCTGG - Intronic
999093453 5:148957606-148957628 GAGGGAACTTGCTCTCCCTCAGG + Intronic
1004603415 6:17172501-17172523 GGACTGACTCACTCTCCCTCTGG - Intergenic
1007288207 6:40763368-40763390 GGACCAAGTTACTCTCCTTCTGG + Intergenic
1008105806 6:47440092-47440114 GAATCAACTTTCACTCCCTCAGG + Intergenic
1008592741 6:53010300-53010322 GCATGAAATTCCTCACCCTCTGG - Intronic
1009467346 6:63988220-63988242 GGATGACCTTCCTCTCACTGAGG + Intronic
1013911652 6:115282672-115282694 GGATGAAGCCACCCTCCCTCTGG + Intergenic
1021775142 7:24046814-24046836 GGCAGAATTCACTCTCCCTCAGG - Intergenic
1024125995 7:46295090-46295112 GGAAAAACTTTCTGTCCCTCAGG + Intergenic
1024692497 7:51818377-51818399 GGATGAACTGCCTCTGCCCCTGG - Intergenic
1024779614 7:52832521-52832543 GGATAAAATTACTTTCCCTTTGG + Intergenic
1025921189 7:65914697-65914719 GCATCTACTTACTCTCCCTCTGG + Intronic
1037510009 8:19573298-19573320 GAATCATCTTATTCTCCCTCTGG + Intronic
1038104136 8:24414464-24414486 GGGTTCACTCACTCTCCCTCTGG + Intergenic
1046292365 8:112179869-112179891 GCAAGAACTCACTCACCCTCAGG + Intergenic
1049104590 8:140603958-140603980 GGATGAGCTGCCCCTCCCTCAGG + Intronic
1049271668 8:141699364-141699386 GGCGGAACTTCCTCTTCCTCGGG - Intergenic
1055187251 9:73471542-73471564 GGACTAACTTGCTCTCCCACTGG - Intergenic
1055234075 9:74098494-74098516 GAATGAACTTAATTGCCCTCTGG - Intergenic
1055793685 9:79950800-79950822 GAGTGAACTTACCCTCCCTGAGG - Intergenic
1056194856 9:84219317-84219339 GCATGAACTTTCCCTGCCTCAGG + Intergenic
1060537967 9:124406704-124406726 GGATAAACTTACACTTCCTCAGG + Intronic
1060855058 9:126908445-126908467 GGATTAACTCACTTTTCCTCAGG + Intergenic
1186315121 X:8361164-8361186 GGATGAATTTACTCTGTTTCTGG - Intergenic
1188545559 X:31301876-31301898 GGTTGAAGTTACTCTACCTCTGG + Intronic
1192917371 X:75666798-75666820 GGAACAAACTACTCTCCCTCAGG + Intergenic
1196922181 X:120595458-120595480 GGGTGAACCTCCTCTCCCTTTGG + Intronic
1198820936 X:140647939-140647961 GGATCATCTTACACTCCCTCAGG - Intergenic
1201396304 Y:13552791-13552813 GGATTAGCTTACTTTCCATCTGG - Intergenic