ID: 912568945

View in Genome Browser
Species Human (GRCh38)
Location 1:110607685-110607707
Sequence TCCTGCCAACGTAATGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912568939_912568945 24 Left 912568939 1:110607638-110607660 CCGGGGAGATGGGGGAGGGCAGA No data
Right 912568945 1:110607685-110607707 TCCTGCCAACGTAATGAAGTAGG 0: 1
1: 0
2: 0
3: 12
4: 82
912568936_912568945 29 Left 912568936 1:110607633-110607655 CCGGGCCGGGGAGATGGGGGAGG 0: 1
1: 0
2: 3
3: 57
4: 665
Right 912568945 1:110607685-110607707 TCCTGCCAACGTAATGAAGTAGG 0: 1
1: 0
2: 0
3: 12
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912568945 Original CRISPR TCCTGCCAACGTAATGAAGT AGG Intronic
906778684 1:48552904-48552926 CCCTGCCAAAGTAATGAGGAGGG - Intronic
906930900 1:50168253-50168275 TCCTGCCACCCTGATGAAGCTGG - Intronic
910567213 1:88657859-88657881 TCCTGGCAACCTTATGACGTAGG + Intergenic
910579441 1:88806529-88806551 TCATGCCAACATTAAGAAGTTGG - Intronic
912568945 1:110607685-110607707 TCCTGCCAACGTAATGAAGTAGG + Intronic
916889118 1:169099404-169099426 TTCTTACAACGTAATGAGGTAGG - Intergenic
920654986 1:207868415-207868437 CCCTGCCAAATTAATAAAGTGGG - Intergenic
921492496 1:215795311-215795333 TCCAGTCAAGGTAATGAAGGGGG - Intronic
1064844110 10:19632250-19632272 TACTGCCATCGTGAAGAAGTTGG + Intronic
1066073310 10:31844789-31844811 TCCTGCTATGGTAATTAAGTTGG - Intronic
1067170616 10:43903191-43903213 TCCTGATAACCTTATGAAGTAGG + Intergenic
1067185035 10:44020241-44020263 TCCTGCCAAGGATAAGAAGTAGG - Intergenic
1067848227 10:49739370-49739392 TCCATACAACTTAATGAAGTAGG - Intronic
1080590813 11:33721851-33721873 TCATGCCAACCTGATGGAGTTGG - Intronic
1082118419 11:48352340-48352362 ACCTGCCAATGTGATCAAGTAGG + Intergenic
1082665119 11:55966549-55966571 TCCTGCCAACGTTGTGATTTTGG - Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1089731464 11:120521997-120522019 TCCAGCCAACCCTATGAAGTAGG + Intronic
1093050997 12:14504588-14504610 TCATGCCAACTCTATGAAGTAGG - Intronic
1099539167 12:83883905-83883927 TCCTGCCAACGTCTTGATCTTGG + Intergenic
1106472364 13:30068422-30068444 TCCTGCCAAATGAATGAAGTGGG - Intergenic
1108714152 13:53062241-53062263 TCCTCCCACCATAAAGAAGTTGG + Intergenic
1111624164 13:90762535-90762557 TCCTGCCAATGTAATTATGCCGG - Intergenic
1121605443 14:95236813-95236835 TCCTCACAACCTCATGAAGTGGG - Intronic
1125551925 15:40551552-40551574 TCCTGCCAATAAAATGCAGTAGG + Intronic
1127059096 15:55163845-55163867 TCCTGCCAACAGAAGGCAGTGGG - Intergenic
1130153575 15:81331035-81331057 TCCTGCCAACGAAATGTTGTGGG + Intergenic
1141400629 16:83744053-83744075 TCATGACAACCTGATGAAGTGGG - Intronic
1144411321 17:15004854-15004876 TCCTCACAACTTTATGAAGTAGG - Intergenic
1153971613 18:10232132-10232154 TCCTGCCCTAGAAATGAAGTTGG + Intergenic
1158127412 18:54116553-54116575 TCCTGCCAAGGTAACGTACTAGG - Intergenic
1159479460 18:68969157-68969179 CCATGCTAACGTAATGAACTGGG + Intronic
1163868221 19:19793413-19793435 TCCTGCAAATATAATGAATTTGG - Intronic
1163902782 19:20120488-20120510 TCCTGCAAATGTAGTGAATTTGG + Intronic
1163911586 19:20199400-20199422 TCCTGCAAATGTAATGAGTTTGG + Exonic
1163954432 19:20622922-20622944 TCCTGCAAATGTAATGAATTTGG - Exonic
1163961395 19:20697451-20697473 TCCTGCAAATGTAATGAATTTGG + Intronic
1164252374 19:23491179-23491201 CCCTGCCAATGTAATAAATTTGG - Intergenic
1164298282 19:23936076-23936098 CCCTGCAAATGTAATGAATTTGG + Intronic
929332686 2:40702787-40702809 TCCTGCCAATGTAATGTACCAGG + Intergenic
930172822 2:48268634-48268656 TCCTCCCAACTTGATGAAATAGG - Intergenic
931102531 2:59018361-59018383 ACCTGCCAAGCTAATGAACTGGG - Intergenic
936887453 2:117329944-117329966 TCATGACAACCTTATGAAGTAGG + Intergenic
940688671 2:156886136-156886158 TCCTGGCAACTTTATGATGTAGG + Intergenic
943562659 2:189482485-189482507 TTCTGCCAAGGTCATGAATTAGG - Intergenic
943809132 2:192162115-192162137 TGATGCCAATGTAATGAAGAAGG + Intronic
1169004425 20:2194967-2194989 TCCTGGCAAATTCATGAAGTGGG - Intergenic
1169027723 20:2384566-2384588 TCCTCCCAACGTGAGGAAGCGGG + Intronic
1173737088 20:45369953-45369975 TCCAGCCTGGGTAATGAAGTCGG - Intronic
1177889086 21:26782948-26782970 TCCTGCCAAGGAAATGTCGTGGG - Intergenic
1178950474 21:36981177-36981199 TCCTGGCAAAATAATGAAGTTGG + Intronic
1181822250 22:25485397-25485419 TCCTGGCAATATTATGAAGTAGG + Intergenic
1183294718 22:37022764-37022786 TCCTGCCAGCGAAATGAAGGGGG - Intronic
952144555 3:30517633-30517655 TCCTTCCAACCACATGAAGTAGG + Intergenic
954102881 3:48390903-48390925 TCCTGAAAACTTATTGAAGTTGG + Intronic
959035342 3:101356743-101356765 TCCTGCAAATGTAATGAATTTGG - Intronic
959416605 3:106083717-106083739 TCCTTCTAACCTAATAAAGTTGG - Intergenic
962643051 3:137408169-137408191 TCCAGGCAAAGAAATGAAGTAGG - Intergenic
965464995 3:169018196-169018218 TCCTGCCAAAGTTTTGCAGTTGG + Intergenic
967547785 3:190752021-190752043 GCCTTCAAACTTAATGAAGTGGG - Intergenic
968735912 4:2296549-2296571 TCCTGCCAGGGGCATGAAGTGGG + Intronic
972443032 4:39115754-39115776 TCCTGATAACCTAATGAAGATGG + Intronic
983270532 4:165556456-165556478 TCCTACCAAGGTGATGAACTGGG - Intergenic
983925792 4:173400687-173400709 TCCTTCCAACCCTATGAAGTAGG + Intronic
984217369 4:176931071-176931093 TCCTTCCAACTAAATCAAGTTGG + Intergenic
984849895 4:184144243-184144265 TCCTGGCAAAGTAACGAAGAGGG - Intronic
992378865 5:76217284-76217306 TCCTGCCAGCCAAAGGAAGTAGG - Intronic
998655590 5:144175188-144175210 TCCTGACAACCCAATGAGGTAGG + Intronic
999545802 5:152627112-152627134 TCCTGACAACTCTATGAAGTAGG - Intergenic
1002926429 6:1608380-1608402 TCCTGCCAACGTGAGGAAGCCGG + Intergenic
1004881200 6:20010235-20010257 TCCTGACAACCTACTGAAGTAGG - Intergenic
1005396420 6:25386653-25386675 TCCTGACAACCCTATGAAGTGGG - Intronic
1006802655 6:36769201-36769223 TCCTAGCAACGTGATGAAATGGG + Intronic
1007638150 6:43313296-43313318 TCCTCCCAACCTCCTGAAGTGGG - Intronic
1010209664 6:73353290-73353312 TCCAGCCAATGCAATGAAGCCGG - Exonic
1013765886 6:113573673-113573695 TCATGCCACCTTATTGAAGTAGG - Intergenic
1014440313 6:121466263-121466285 TCCAGCCTAGGCAATGAAGTTGG + Intergenic
1015318124 6:131840583-131840605 TCCTGCCAACTTTGTGAGGTGGG + Intronic
1018367253 6:163133552-163133574 TCCTGCCAAGAGAATGAAGCTGG - Intronic
1020503981 7:8960132-8960154 TCCTGTCAAGATAATGAAGCAGG + Intergenic
1020837738 7:13175117-13175139 TCATAACAACCTAATGAAGTAGG + Intergenic
1023581918 7:41692638-41692660 TCCTGCCAAAGACATGAGGTCGG - Intronic
1025772183 7:64520624-64520646 TCCTGCAAATGTAATGAATTTGG - Exonic
1025824110 7:64996928-64996950 TCCTGCCAGCCTGATCAAGTAGG + Intronic
1046539153 8:115556709-115556731 ATCTGGCAACTTAATGAAGTTGG + Intronic
1047645817 8:126868440-126868462 TCTTGCCAAAGTTGTGAAGTAGG - Intergenic
1048727826 8:137407046-137407068 TCATGCAAACGTCATGAAGTAGG - Intergenic
1056234164 9:84574997-84575019 TCCTGCCAGCCTGGTGAAGTGGG + Intergenic
1059920882 9:119158527-119158549 TCATGCCAACAAGATGAAGTAGG + Intronic
1191667433 X:63717777-63717799 TCCTGACAACTTAATGAGATAGG + Intronic
1197689253 X:129479057-129479079 TCCTAACAACCTCATGAAGTAGG - Intronic
1197929531 X:131680121-131680143 TCCTGCCATCAAAATGAAGTTGG - Intergenic
1198021498 X:132662956-132662978 AGCTGCCAACGTATTGCAGTGGG - Intronic
1200838113 Y:7752759-7752781 TCCTGCCAACAAACTGAAGGAGG + Intergenic
1201675003 Y:16571220-16571242 TAGTGCCAAAGTAAGGAAGTGGG + Intergenic