ID: 912569758

View in Genome Browser
Species Human (GRCh38)
Location 1:110612884-110612906
Sequence ACTTGAAGTCAGACAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912569753_912569758 21 Left 912569753 1:110612840-110612862 CCTCGAAAGCTCTAACTGGCTTA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 912569758 1:110612884-110612906 ACTTGAAGTCAGACAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912569758 Original CRISPR ACTTGAAGTCAGACAGGCCT GGG Intronic
No off target data available for this crispr