ID: 912570320

View in Genome Browser
Species Human (GRCh38)
Location 1:110616512-110616534
Sequence GCTTATTTATGATCTAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912570320_912570327 29 Left 912570320 1:110616512-110616534 CCAGAGTTAGATCATAAATAAGC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 912570327 1:110616564-110616586 AGCCTGGGAACAACCGAGCCAGG No data
912570320_912570322 -6 Left 912570320 1:110616512-110616534 CCAGAGTTAGATCATAAATAAGC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 912570322 1:110616529-110616551 ATAAGCCAGCATGGTTCCTAAGG No data
912570320_912570326 14 Left 912570320 1:110616512-110616534 CCAGAGTTAGATCATAAATAAGC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 912570326 1:110616549-110616571 AGGAAAAAACAACAGAGCCTGGG No data
912570320_912570325 13 Left 912570320 1:110616512-110616534 CCAGAGTTAGATCATAAATAAGC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 912570325 1:110616548-110616570 AAGGAAAAAACAACAGAGCCTGG 0: 1
1: 0
2: 7
3: 137
4: 1715
912570320_912570328 30 Left 912570320 1:110616512-110616534 CCAGAGTTAGATCATAAATAAGC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 912570328 1:110616565-110616587 GCCTGGGAACAACCGAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912570320 Original CRISPR GCTTATTTATGATCTAACTC TGG (reversed) Intronic
912570320 1:110616512-110616534 GCTTATTTATGATCTAACTCTGG - Intronic
916157795 1:161873427-161873449 GATGACTTATGATCTGACTCAGG + Intronic
917996298 1:180441950-180441972 TCTTATTCCTGATCTACCTCTGG + Intronic
921447257 1:215261235-215261257 GCTTAATTATGCTCTAGCTTAGG - Intergenic
921995760 1:221416239-221416261 CCTCATCTATGATCTAACCCAGG - Intergenic
922054404 1:222026758-222026780 GCTCATTTATGCTATATCTCAGG + Intergenic
1065072782 10:22043766-22043788 GCTTTTTTAAGAGCCAACTCTGG + Intergenic
1067988209 10:51177429-51177451 GCTTATTTCTGATATGACTAAGG + Intronic
1068531693 10:58195912-58195934 ACTTTTTTATAATCTTACTCAGG - Exonic
1069487127 10:68830879-68830901 GCTGATTTCTGGTCTAACTTGGG + Intronic
1078391540 11:10939304-10939326 GCTTCTTTATTATCTAAATTTGG + Intergenic
1079042841 11:17074830-17074852 GCTTATTCATGGTCTAAATCTGG + Intronic
1080197403 11:29628652-29628674 GTTTATTTAGCATCTAACACAGG - Intergenic
1081285676 11:41266817-41266839 GCTTAATAATGATCTAATTTAGG + Intronic
1087478144 11:98664019-98664041 GCATTTTTATGATCTAGCTATGG - Intergenic
1088292336 11:108254066-108254088 GCTTATATATGATTCAACTTTGG + Intronic
1088729209 11:112665941-112665963 GCTTATTAATGGTTTAACCCTGG + Intergenic
1089958417 11:122594414-122594436 GCTTCTTTAGGATCTGACTTAGG - Intergenic
1099162841 12:79266339-79266361 GCTTATATATGGTATTACTCAGG + Intronic
1099459435 12:82904450-82904472 GCTAATTTATGGTTTAAATCTGG + Intronic
1100854126 12:98743298-98743320 ACTTATTAATGAACTAACTAGGG + Intronic
1104747148 12:131217861-131217883 GTTTAAAAATGATCTAACTCAGG + Intergenic
1106918024 13:34536257-34536279 GCTTATTTATGACACAACTAGGG + Intergenic
1109091988 13:58059129-58059151 GCTTATTTATCACGTTACTCTGG - Intergenic
1109168315 13:59063526-59063548 GCTTATTTATGTTAAAACTATGG - Intergenic
1111070597 13:83161068-83161090 GTTTATTTATGTTGTAACACAGG + Intergenic
1114152623 14:20061918-20061940 ACATTTTTATGACCTAACTCTGG - Intergenic
1116857870 14:49969535-49969557 GCTAATTTATTATCTAAATTAGG + Intergenic
1116857932 14:49970015-49970037 CCCTATTTAGAATCTAACTCAGG - Intergenic
1118366146 14:65098164-65098186 GCACATTTAGGAACTAACTCTGG + Intronic
1119258641 14:73222529-73222551 GATCATTTGTGATCTAACCCTGG + Exonic
1126651919 15:50931668-50931690 GTTTATTTATGTTCTATCTGTGG - Intronic
1127520093 15:59735245-59735267 GTTTATTTATGAGCCAACTATGG - Intergenic
1128502309 15:68235172-68235194 GCTTATAGATGAGTTAACTCAGG + Intronic
1129806600 15:78466133-78466155 GCTAATGTATCATTTAACTCAGG - Intronic
1130822002 15:87505785-87505807 GCTAATTTATAATCCAACTAAGG + Intergenic
1139267001 16:65649421-65649443 GCATTTTTATGTTCTAAATCTGG + Intergenic
1145789392 17:27616547-27616569 GCTTATCTTTGATCTCTCTCTGG + Intronic
1149703448 17:58674367-58674389 ACTTATTTATGATGAAAGTCCGG + Intronic
1149800971 17:59566942-59566964 GCTTCTTTATGGTCTATTTCAGG + Intronic
1149921245 17:60661397-60661419 GAGTATTTATGCTTTAACTCTGG + Intronic
1155887332 18:31224061-31224083 GATGATTTATGATTTAAATCAGG - Intergenic
1157882802 18:51337591-51337613 TTTTATTTATGGTCTACCTCAGG + Intergenic
1159345397 18:67196141-67196163 GTTTAGTAAAGATCTAACTCTGG - Intergenic
1159768336 18:72518064-72518086 AATTATTTATGGTGTAACTCAGG - Intergenic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1163219760 19:15910110-15910132 ACTTTTTTATAATCTTACTCAGG - Intergenic
930538912 2:52680405-52680427 GATTATTTAAGATCAAACACTGG + Intergenic
930594302 2:53367194-53367216 GCTAATTTATGCTCTAAAGCTGG + Intergenic
931694721 2:64863196-64863218 GCTTACTGATGATCTGACCCAGG - Intergenic
937588736 2:123588654-123588676 GCATATTTTTGATATATCTCAGG - Intergenic
938230213 2:129652116-129652138 GCTTAATTATGAAACAACTCAGG - Intergenic
940385693 2:153068783-153068805 GCTTCTTTTTGATCTAACAGTGG + Intergenic
941248128 2:163125939-163125961 GCTTCTTTGTGGCCTAACTCAGG + Intergenic
941257438 2:163250845-163250867 GCTTATTTTTCATATAACACAGG - Intergenic
944207089 2:197168397-197168419 CCTTATTTATTTTCAAACTCAGG + Intronic
947574276 2:231260246-231260268 CCTTTTTTATGATCAATCTCTGG - Intronic
1169890791 20:10450056-10450078 GCTCATTTATGATCTATCCAAGG + Intronic
1175496953 20:59421572-59421594 TGCTATTTATGATCTAACTTTGG - Intergenic
950578565 3:13847582-13847604 GCCTATTTATGTGCTAAATCCGG - Intronic
951354767 3:21651356-21651378 TCTCATTTATGTTCTGACTCAGG + Intronic
955079389 3:55644109-55644131 GCTCATTGATGCTCTAACTTGGG - Intronic
955142847 3:56286598-56286620 ACTTACTTATTATCTAATTCAGG + Intronic
957705731 3:83780317-83780339 GCTTATTTCTGATGTAACCTTGG - Intergenic
960176839 3:114527308-114527330 GCTTATTGATGAACCAACACTGG - Intronic
960452613 3:117829066-117829088 GATTATTCATTATGTAACTCTGG + Intergenic
960746250 3:120892349-120892371 GCTTAATTATCTTCAAACTCAGG + Intergenic
962274698 3:134003176-134003198 GCTTATTGATGATTTCATTCAGG - Intronic
962603280 3:137011396-137011418 GCTCATTTAGGACCTACCTCTGG + Intergenic
964445052 3:156749963-156749985 ACTTTTTTACCATCTAACTCAGG + Intergenic
966465440 3:180226840-180226862 GATTATTTATGCCCAAACTCTGG - Intergenic
968955119 4:3715166-3715188 GCTTGTTTTTGATCAAAGTCAGG - Intergenic
970012301 4:11472630-11472652 GCTTTTTTATGATCAGATTCAGG + Intergenic
971100631 4:23462914-23462936 GCTTATTTATTTTGTAGCTCTGG + Intergenic
972878186 4:43391602-43391624 CATTATTTATCATCAAACTCAGG + Intergenic
973122175 4:46535145-46535167 GCATAGTGATGATCTAAGTCAGG - Intergenic
974408407 4:61507047-61507069 GATTAGTTCTGATCTAATTCAGG - Intronic
978843691 4:113246559-113246581 GCTTATTTATTATTTAAATGTGG + Intronic
979702127 4:123681847-123681869 GCTATCTTATTATCTAACTCAGG + Intergenic
979776213 4:124591382-124591404 GGTAAATTATAATCTAACTCTGG - Intergenic
979938504 4:126728062-126728084 GTTTATTTAGGAGCTAATTCTGG - Intergenic
981113735 4:140965717-140965739 GCTTGTTTATTCTCTATCTCTGG - Intronic
984247054 4:177287286-177287308 GCCTCTTTATTTTCTAACTCTGG - Intergenic
985281600 4:188292044-188292066 GTTTATTTAACCTCTAACTCAGG - Intergenic
991379955 5:66010254-66010276 GCTTACTTATGATTAAATTCAGG + Intronic
997788461 5:136735426-136735448 GATTATTTATGATCAAACTAGGG - Intergenic
999862649 5:155665181-155665203 GATTATTAATGATCTAGGTCTGG + Intergenic
1002798590 6:498525-498547 GTTTTTATATGATTTAACTCAGG - Intronic
1005109171 6:22260163-22260185 GCATATTTATGATCTGACTTAGG - Intergenic
1005371915 6:25142307-25142329 GCTTAATTATGATCTAAACTAGG + Intergenic
1006615696 6:35325085-35325107 GTTTTCTTATGATCTAACTGTGG + Intergenic
1008525076 6:52399535-52399557 GGTTATATATTATTTAACTCTGG + Intronic
1015206702 6:130648555-130648577 GCTTTTCTAACATCTAACTCAGG + Intergenic
1017655570 6:156625683-156625705 GCTTATTTGTGTTCTAGCTGAGG + Intergenic
1020486270 7:8724808-8724830 GCTTATTTATGAGATCTCTCTGG + Intronic
1021156107 7:17212274-17212296 TCTTATTTATCATCTTCCTCTGG - Intergenic
1026100344 7:67379005-67379027 GTTTATTTCTGATCTATTTCGGG + Intergenic
1028002497 7:85517038-85517060 CCTTATTTTTGCTCTGACTCTGG + Intergenic
1028230153 7:88297731-88297753 GCATATGTATGAACTAACTGTGG + Intronic
1029908793 7:104121567-104121589 TCTTATTTAGTATCTAGCTCAGG - Intergenic
1032409101 7:131680759-131680781 GTTTATTTGTGAACTAACTGAGG - Intergenic
1033642765 7:143278231-143278253 GCATATTTATGGTCTCTCTCTGG + Intergenic
1035216397 7:157370916-157370938 GCTTATTCATGATGTAGTTCAGG + Intronic
1041349739 8:56936344-56936366 ACTGATTTATGATATAACACTGG - Intergenic
1046479211 8:114792787-114792809 ATTTATTTATCATCTACCTCTGG + Intergenic
1046895726 8:119470264-119470286 GCTTTTTTATGACCTAGCTTCGG - Intergenic
1047836119 8:128695143-128695165 GCTTTTTTCTGATTTCACTCTGG + Intergenic
1050446664 9:5729792-5729814 TCTTATTTATGTTCTGACACAGG - Intronic
1050656597 9:7835296-7835318 TCTTATATATGATATAACTGAGG - Intronic
1056565052 9:87764320-87764342 GGTTTTTTATGATCTGATTCAGG + Intergenic
1058471984 9:105289203-105289225 GCCTATTTATGTGCTAACTGCGG + Intronic
1060245127 9:121939257-121939279 GTTTATTTATAATATAACTAGGG + Intronic
1188069456 X:25701125-25701147 GCTTCTTTATTATCCAACTTAGG + Intergenic
1193629951 X:83872485-83872507 GTTTATTTCTGATTTAACTTGGG + Intronic
1194095490 X:89633644-89633666 GCATATTTATGAGCTAAGACTGG - Intergenic
1195557655 X:106245535-106245557 ACTTATTTTTGATCCAATTCTGG + Intergenic
1200448123 Y:3289823-3289845 GCATATTTATGAGCTAAGACTGG - Intergenic
1201639462 Y:16164004-16164026 GCATTTCTATAATCTAACTCTGG - Intergenic
1201663351 Y:16421320-16421342 GCATTTCTATAATCTAACTCTGG + Intergenic