ID: 912572720

View in Genome Browser
Species Human (GRCh38)
Location 1:110636360-110636382
Sequence CTGTGCAAATGTAAGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912572720_912572723 4 Left 912572720 1:110636360-110636382 CCACCTTTCTTACATTTGCACAG No data
Right 912572723 1:110636387-110636409 GCTGATTCCCAGGTGTCTGCAGG No data
912572720_912572722 -6 Left 912572720 1:110636360-110636382 CCACCTTTCTTACATTTGCACAG No data
Right 912572722 1:110636377-110636399 GCACAGTTTCGCTGATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912572720 Original CRISPR CTGTGCAAATGTAAGAAAGG TGG (reversed) Intergenic
No off target data available for this crispr