ID: 912576049

View in Genome Browser
Species Human (GRCh38)
Location 1:110674106-110674128
Sequence GAGAGCTCCGGGCCGGCCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912576049_912576063 23 Left 912576049 1:110674106-110674128 CCCCGGGCCGGCCCGGAGCTCTC 0: 1
1: 0
2: 4
3: 19
4: 163
Right 912576063 1:110674152-110674174 CCTGGCGCTGGAAGTCGCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 118
912576049_912576064 24 Left 912576049 1:110674106-110674128 CCCCGGGCCGGCCCGGAGCTCTC 0: 1
1: 0
2: 4
3: 19
4: 163
Right 912576064 1:110674153-110674175 CTGGCGCTGGAAGTCGCGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 105
912576049_912576065 25 Left 912576049 1:110674106-110674128 CCCCGGGCCGGCCCGGAGCTCTC 0: 1
1: 0
2: 4
3: 19
4: 163
Right 912576065 1:110674154-110674176 TGGCGCTGGAAGTCGCGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 56
912576049_912576058 5 Left 912576049 1:110674106-110674128 CCCCGGGCCGGCCCGGAGCTCTC 0: 1
1: 0
2: 4
3: 19
4: 163
Right 912576058 1:110674134-110674156 ACTCGAAGAGCAGCCACACCTGG 0: 2
1: 1
2: 2
3: 6
4: 100
912576049_912576059 11 Left 912576049 1:110674106-110674128 CCCCGGGCCGGCCCGGAGCTCTC 0: 1
1: 0
2: 4
3: 19
4: 163
Right 912576059 1:110674140-110674162 AGAGCAGCCACACCTGGCGCTGG 0: 3
1: 0
2: 2
3: 23
4: 362
912576049_912576061 20 Left 912576049 1:110674106-110674128 CCCCGGGCCGGCCCGGAGCTCTC 0: 1
1: 0
2: 4
3: 19
4: 163
Right 912576061 1:110674149-110674171 ACACCTGGCGCTGGAAGTCGCGG 0: 1
1: 0
2: 1
3: 10
4: 94
912576049_912576066 30 Left 912576049 1:110674106-110674128 CCCCGGGCCGGCCCGGAGCTCTC 0: 1
1: 0
2: 4
3: 19
4: 163
Right 912576066 1:110674159-110674181 CTGGAAGTCGCGGCGGGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912576049 Original CRISPR GAGAGCTCCGGGCCGGCCCG GGG (reversed) Exonic
900180134 1:1307666-1307688 GTCAGCGCCGGGCCGGGCCGCGG - Intronic
900511531 1:3063169-3063191 GAGAGTTCCGGGAAGGCCGGGGG + Intergenic
900545783 1:3228494-3228516 GGGAGCTCTGGGCCAGCCCCAGG + Intronic
900929909 1:5729967-5729989 AAGAGCTCCTGGCCAGCCTGGGG + Intergenic
901054030 1:6440441-6440463 GTGAGCTCCGGGCCCGGGCGGGG + Intronic
903034825 1:20486573-20486595 GAGGGCTCCAGGGCGACCCGCGG + Intergenic
905239643 1:36573254-36573276 GAGAGGTCCTGACTGGCCCGTGG - Intergenic
905884448 1:41484327-41484349 AAGAGCTCCAGGCCAGCCCAGGG + Intronic
912576049 1:110674106-110674128 GAGAGCTCCGGGCCGGCCCGGGG - Exonic
922116471 1:222618359-222618381 GCGACCCCCGGGCCGGCCAGGGG - Intronic
922461400 1:225816813-225816835 GGGAGCCCCGAGCCAGCCCGCGG - Intronic
1064110985 10:12538784-12538806 GAGAGCTCCTGACCTGCCCTGGG - Intronic
1069569729 10:69487052-69487074 CAGAGCTCCTGGCCAGCCTGCGG + Intronic
1069569812 10:69487514-69487536 CAGAGCTCCCGGCCGCCCTGAGG + Intronic
1071544821 10:86521426-86521448 GAGGGTTCCGCGCCCGCCCGCGG - Exonic
1076372293 10:129963576-129963598 GAGGGGGCCGGGCCGGGCCGGGG + Intronic
1077295121 11:1822930-1822952 GAGGGCTCAGGGCAGGCCCTAGG - Intergenic
1077500873 11:2909318-2909340 GAGCGCTCCGGGCAGGCGCGAGG - Exonic
1078631789 11:13010030-13010052 GAGCGCCCCTGTCCGGCCCGCGG + Intergenic
1084019475 11:66409218-66409240 GCGAGCCCCGCGCCGGGCCGGGG + Intergenic
1084517295 11:69643781-69643803 GGGAGGTGCGGGCCAGCCCGGGG - Intronic
1085306135 11:75487113-75487135 GAGAGCACAGGGCAGGGCCGGGG - Intronic
1088481716 11:110301165-110301187 GCGGGCTGCGGGCCGGCCTGCGG + Intergenic
1090363153 11:126187073-126187095 GAGAGCTACGGGCAGGGCCTTGG - Intergenic
1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG + Exonic
1096122011 12:49094430-49094452 CAGAGCTGCGGGCCGGGCCGGGG - Exonic
1101716818 12:107319280-107319302 GGGACCGCCGGGCCTGCCCGGGG - Exonic
1101999762 12:109549998-109550020 GAGAGTCCCTGGCCGGGCCGGGG + Intergenic
1102197116 12:111033885-111033907 GGGAGCTCGGCGCCCGCCCGGGG - Intergenic
1102438176 12:112941577-112941599 GAGAGCTGTGCCCCGGCCCGAGG - Exonic
1102910375 12:116709021-116709043 GAGAGCTCCACGCAGGCACGGGG + Intergenic
1103565265 12:121812121-121812143 GGAAGCTCCGGGCCGGCCCGCGG + Intronic
1104834172 12:131776657-131776679 GAGAGCTCCAGCCCAGCCCGCGG - Intronic
1104944483 12:132409536-132409558 GAGAGGTAGGGGCAGGCCCGGGG + Intergenic
1113715140 13:112499441-112499463 GAGAGCTCCTGGCCCGCCGTGGG - Intronic
1118610028 14:67532965-67532987 GAGAGCTCCGGGCCGGCGCCCGG + Intronic
1119505909 14:75172983-75173005 GGGAGCTCCCGGCCCACCCGAGG - Intronic
1122470918 14:101965177-101965199 GGGGGCTCCGGGCCGGGCAGTGG - Intronic
1123964236 15:25439076-25439098 GAGGGCTCCAGGCCGGGACGCGG + Intergenic
1124142282 15:27088238-27088260 GAGTGCTCGGGGCGGGCGCGGGG + Intronic
1124377850 15:29139997-29140019 GAGGGCACCTGGCCGGCCTGCGG + Intronic
1125775405 15:42208191-42208213 GAGTGTTCCGGGCCGGGCTGGGG + Exonic
1127267995 15:57376572-57376594 GTGAGCTCCGGGCTGGAGCGGGG + Intronic
1129116478 15:73368023-73368045 GACAGCGAAGGGCCGGCCCGCGG - Exonic
1129273865 15:74433200-74433222 CCGAGCTCCGGGCCGGGGCGGGG + Intronic
1129675971 15:77632619-77632641 GGCGGCTCCGGGCCGGCCCAGGG - Intronic
1132527828 16:426214-426236 TGGAGCGCCGGGCCGGCCCCGGG + Exonic
1132891491 16:2207017-2207039 GGGACCTGCGGGCCGGGCCGGGG - Exonic
1133227865 16:4351142-4351164 GCGAGCTCCGGGCTGGGCGGCGG - Intronic
1133738730 16:8635241-8635263 TGGAGCTCGGGGCCGGCACGGGG + Exonic
1136398484 16:30005465-30005487 GAGGGCGCCGGGCGGGGCCGTGG - Exonic
1136460432 16:30407329-30407351 GAGACCTCCAAGCCGGCCCCAGG + Exonic
1137467182 16:48720468-48720490 GACAGCTCCAGGCCTGCCTGTGG + Intergenic
1137783127 16:51114531-51114553 TGGAGCTCCGGGCCTGCCCCTGG - Intergenic
1137787550 16:51151141-51151163 GAGTGCTCCGGCCCGCGCCGTGG - Intronic
1142156417 16:88534603-88534625 GCGCGCCCCTGGCCGGCCCGGGG + Exonic
1144816694 17:18039903-18039925 GTGAGCGCCGGGCCGGGCCGGGG + Intronic
1147743193 17:42680189-42680211 GAGCGCTCCCAGCCGGGCCGCGG - Exonic
1148855308 17:50575945-50575967 TGGATCTCCGGGCTGGCCCGGGG - Exonic
1150211935 17:63446454-63446476 GCCAGCTCCGGGCCCGCACGTGG + Intergenic
1150336473 17:64334222-64334244 GAGAGCTGGGCGCTGGCCCGGGG - Intronic
1150830120 17:68511882-68511904 GAGGGCCCCGGGCCGGGGCGGGG - Intronic
1152288274 17:79424719-79424741 TGGAGCTCCGGCCCGGCCCGAGG - Intronic
1152379270 17:79934080-79934102 CAGAGAGCCGGGCCTGCCCGAGG + Exonic
1152432983 17:80260135-80260157 GAGCGCTCCGCGCGGGGCCGCGG + Intergenic
1152781578 17:82229346-82229368 GTGGGCGCCGGGCCGGACCGGGG - Intronic
1158478900 18:57803433-57803455 GCAAGCCCCGGGGCGGCCCGAGG + Intergenic
1160769548 19:824137-824159 GAGAGTTCCGAGCAGGCCGGAGG + Intergenic
1160919180 19:1511924-1511946 CTGAGCTCCGGGGCAGCCCGTGG + Intronic
1161333843 19:3700479-3700501 GGGCGCGCCGGGCCGGCGCGGGG + Exonic
1161739202 19:6010111-6010133 GAGAGGCCCGGTCAGGCCCGGGG - Intronic
1162321188 19:9971232-9971254 TAGATCTCCGGGCAGCCCCGTGG + Exonic
1162832979 19:13298670-13298692 GAGGGCAGCCGGCCGGCCCGGGG - Exonic
1164373006 19:27657929-27657951 GAGAGCTCCTGGCTGACCCCAGG - Intergenic
1165392275 19:35545534-35545556 GAGAGCCCGTGGCCGGCCCTGGG - Intergenic
1166108354 19:40608534-40608556 GGAAGCTCAGGGCCGGGCCGGGG - Exonic
1167739028 19:51312747-51312769 GGGAGGGCCGGGCCGGGCCGGGG - Intronic
1168316693 19:55487701-55487723 GTGAGCTCAGGGGCAGCCCGAGG + Intergenic
1202647024 1_KI270706v1_random:152516-152538 GAGAGATCGGGGCCGCCCCAGGG + Intergenic
925080202 2:1056970-1056992 GAGAGCGCGGGGCCACCCCGTGG + Intronic
926077084 2:9950883-9950905 GCGCGCCCCGGGCCGGCCCCGGG - Intergenic
935746480 2:106194009-106194031 GAAAGCGCCGGCCCCGCCCGGGG + Intronic
937877447 2:126836366-126836388 GAGAGCTGCGGGCAGGAACGCGG - Intergenic
940453868 2:153872429-153872451 GAGCGCCCCGGGCCGGTCCCAGG + Intronic
940954419 2:159712391-159712413 GAGAGCTGCGGGCGGGCTGGAGG - Intergenic
945305572 2:208255544-208255566 GAGTGCTCCCGGCCAGCGCGGGG + Intronic
947665701 2:231904226-231904248 AAGAGCTCTGGGCCGGCAGGCGG - Intergenic
947834389 2:233164711-233164733 GAGCGCTGCTGGTCGGCCCGTGG + Intronic
948559881 2:238845822-238845844 GATAGCTCCAGGGCGCCCCGGGG + Intergenic
948922981 2:241074584-241074606 GTGACCTCAGGGCCAGCCCGGGG - Intronic
1168804297 20:663524-663546 AAAAGTTCCGGGCCGGGCCGGGG + Exonic
1169044417 20:2524634-2524656 GAGAGCTGCGGGCCCCGCCGGGG + Intronic
1172224919 20:33299196-33299218 GAGACCTCCGGGCCCGTCCTCGG - Intronic
1172951240 20:38724595-38724617 GAGAGCCCCGGGGCGCCGCGCGG + Exonic
1176048074 20:63102861-63102883 GGGAGCTGCGGGCCGCTCCGGGG + Intergenic
1176604845 21:8820258-8820280 GAGAGATCGGGGCCGCCCCAGGG - Intergenic
1178907666 21:36650012-36650034 TAAAGCACCGGGCCTGCCCGGGG + Intergenic
1179626499 21:42652531-42652553 GAGAGCTCCTTGCCTGTCCGTGG - Intergenic
1179810378 21:43865687-43865709 GAGGGGCCCGGGCCGGGCCGAGG + Intronic
1179998584 21:44985084-44985106 GAGACTTCAGGGCCGGCCCAAGG - Intergenic
1180064556 21:45405765-45405787 GAGGGCTCGGGGCGGGGCCGCGG + Intronic
1180101641 21:45590480-45590502 CAGAGCTCCGTGCCCGCCCCGGG + Intergenic
1180163063 21:46006684-46006706 GAGGGCTCAGGGCCGGCTCGGGG - Intergenic
1180347135 22:11711863-11711885 GAGAGATCGGGGCCGCCCCAGGG - Intergenic
1180622478 22:17171480-17171502 GGGAGCTCTGTGCCGTCCCGCGG + Intergenic
1184250374 22:43256801-43256823 GAGAGCCCCAGGCCGGACAGTGG + Intronic
1184645418 22:45892332-45892354 GAGAGCTCCTGCCCAGCCCGGGG + Intergenic
1185344990 22:50307187-50307209 GGGCGCTCCGGGCCGGCCCCAGG - Intronic
956659389 3:71583309-71583331 GGGGGCTGCGGGCCGGCGCGCGG - Intronic
960747663 3:120908134-120908156 GCAAGCTAGGGGCCGGCCCGGGG + Exonic
960994739 3:123333419-123333441 GGGAGCTCCAGGCCGGGCCCTGG - Intronic
964482844 3:157159756-157159778 AGGAGCGCCCGGCCGGCCCGGGG + Intronic
968051579 3:195658302-195658324 GAGAGCCCTGGGCCGGTGCGAGG + Intergenic
968104237 3:195990031-195990053 GAGAGCCCTGGGCCGGTGCGAGG - Intergenic
968278213 3:197456839-197456861 CAGAGCACCGGGCTGGCCGGTGG - Intergenic
968302538 3:197627621-197627643 GAGAGCCCTGGGCCGGTGCGAGG - Intergenic
968541653 4:1171240-1171262 GTGAGCGCGGGGCCGGCCGGGGG - Intronic
968701456 4:2059920-2059942 GGGAGCTCCGCGCCGGCCCGAGG - Intronic
969514156 4:7637309-7637331 GGGAACTCAGGGCAGGCCCGAGG - Intronic
970394668 4:15654744-15654766 GAGAGCCCCGAACAGGCCCGGGG + Intronic
973387729 4:49524529-49524551 GAGAGATCGGGGCCGCCCCAGGG - Intergenic
973619473 4:52712569-52712591 GAGGGCGCCCGGCCGGCCCGTGG + Intergenic
974047346 4:56908611-56908633 GAGGGCCGCGGGCCGGCGCGGGG - Intronic
975139203 4:70902691-70902713 GAGCGCTCCGCGCAGTCCCGGGG - Intronic
978490093 4:109302879-109302901 GGGTTCCCCGGGCCGGCCCGCGG - Intergenic
978741874 4:112145816-112145838 CAGAGCTGCGGCGCGGCCCGCGG - Intronic
981782558 4:148444453-148444475 GAGAGCGCAGGGGCGGCCCCGGG - Intronic
984992758 4:185396782-185396804 GGGACTTCCGGGCCGGCCCTTGG - Exonic
985394274 4:189525498-189525520 GAGAGCCCTGGGCCCGCCCCAGG - Intergenic
985497642 5:218555-218577 GAGAGCCCTGGGCCGGTGCGAGG + Intronic
985995369 5:3594651-3594673 GAGAGCTCCGGACGGTGCCGTGG - Intergenic
987258434 5:16179999-16180021 GTGAGCGCGGGGCCGGCCCGTGG - Intronic
987915311 5:24205211-24205233 GAGAGCTCCTGGCAAGCCCCAGG - Intergenic
993503912 5:88689684-88689706 GAGAGCTTCCGGCAGCCCCGCGG - Intergenic
993901232 5:93585184-93585206 GGGCGCTCCGGGCTGGCCCGGGG - Exonic
997265171 5:132490990-132491012 GAGCGCTCGGGGCGGGCCCGCGG - Intergenic
999375103 5:151081110-151081132 GCGCGCTCCGGGCGGGCCCGCGG + Intronic
1000060496 5:157651552-157651574 GAAGGCCCCGGGCCGGCCCTCGG - Exonic
1002158987 5:177303901-177303923 GCGAGGGCCGGGCCGGGCCGGGG - Exonic
1002469844 5:179428763-179428785 GAGAGCATGGGGCCGGCCAGTGG - Intergenic
1006263377 6:32895163-32895185 GCCTCCTCCGGGCCGGCCCGTGG + Intergenic
1006592254 6:35166928-35166950 GACAGCTCAGGACCGGCCCCAGG - Intergenic
1007765027 6:44155076-44155098 GAGAGCCCCGAGCCGGCCCCGGG + Exonic
1007785268 6:44276195-44276217 CCGGGCCCCGGGCCGGCCCGCGG - Exonic
1008894988 6:56542702-56542724 GGGAGCTCCGGGGCTGTCCGCGG + Intronic
1008920896 6:56843560-56843582 GCGTGCTTCGGGCCGGGCCGAGG + Intronic
1017871859 6:158493607-158493629 GAGAGCTCCTGAGCAGCCCGGGG - Exonic
1019189745 6:170244940-170244962 GAGAGCTCAGGGAGGCCCCGGGG + Intergenic
1019828365 7:3301710-3301732 GAGGGCTCCGGGCCGGGGCGCGG - Exonic
1020016912 7:4836522-4836544 GAGAGCTCCGGGCATCCCCCAGG + Exonic
1020211797 7:6163522-6163544 GAGGGCTCAGGGCTGGACCGGGG - Exonic
1022714954 7:32891290-32891312 CGGAGCTCCGGGCAGGTCCGCGG - Intronic
1029170559 7:98626892-98626914 GAGAGCTCAGGGCCAGCGTGGGG + Intronic
1029438125 7:100573780-100573802 GAGAGGGCCGGGCCGGGCGGCGG - Intronic
1029701489 7:102249157-102249179 GCGGGCTCAGGTCCGGCCCGGGG - Exonic
1030138640 7:106284364-106284386 GAGCGCGCCGGGCTGGCCCGGGG + Intronic
1032090688 7:128910204-128910226 GAGGGCTCGGTGCCGGCACGGGG - Intronic
1034147175 7:148883946-148883968 GTGAGCTTCGGGCTGGCCCGCGG - Intronic
1035431705 7:158828437-158828459 GCGCGCTCCGGGCAGGGCCGCGG + Intronic
1036772241 8:11587263-11587285 GAGAGCTCCTGGCCGCCTCAGGG + Intergenic
1039063691 8:33591979-33592001 GAGAGGTCAGGCCAGGCCCGTGG - Exonic
1046932560 8:119855941-119855963 GCGCGCTGCGGGCCCGCCCGCGG + Exonic
1049218283 8:141417648-141417670 GAGGGCGCCGGGCCGGCCGGCGG + Intronic
1049397796 8:142409637-142409659 GAGCGCTCAGGGCAGGGCCGAGG + Intergenic
1049661031 8:143819841-143819863 GAGAGCTCTTGGCCTGCCTGGGG - Intronic
1049664668 8:143837600-143837622 GTGAGCAGCAGGCCGGCCCGGGG - Intronic
1049989291 9:976844-976866 GTGTGCTCCGGGGCGGCCGGAGG - Intergenic
1050472438 9:6007657-6007679 CAGACCTCAGGGCCGGCCCACGG - Exonic
1052970149 9:34372427-34372449 GGCAGCGCCGGGCCGGGCCGTGG - Exonic
1052999139 9:34567924-34567946 GAGAGATCCTGGCCAGCCCCAGG - Intronic
1055321673 9:75088495-75088517 GAGTGCTCCGCCCCGCCCCGCGG - Intergenic
1056684252 9:88746617-88746639 CAGAGCTCCGGGCTGCCCCACGG - Intergenic
1057047993 9:91900478-91900500 GAGGGCGCCGGGCCTGCACGTGG + Intronic
1057054449 9:91949993-91950015 CAGAGCTTCGGGCCGGGGCGCGG + Exonic
1057636985 9:96778009-96778031 GAGAGCGCCGGGCCTCCACGCGG - Exonic
1057802320 9:98198010-98198032 GTGGGCTCCTGGCTGGCCCGAGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060583110 9:124770202-124770224 GAGGGCTCCAGCCCGCCCCGGGG - Intronic
1061449730 9:130661509-130661531 GAGAGCTCCGGCCCGGCCGAGGG + Intergenic
1062230793 9:135480293-135480315 GGGAGCTTTGGCCCGGCCCGGGG + Intronic
1062344392 9:136108236-136108258 GAGAGCTGGGGGCAGGCCCAAGG + Intergenic
1062547460 9:137070121-137070143 GCGCGCCCCGGCCCGGCCCGGGG - Exonic
1062596425 9:137301947-137301969 CTGAGCCCCGGCCCGGCCCGCGG - Exonic
1203696990 Un_GL000214v1:108682-108704 GAGAGATCGGGGCCGCCCCAGGG + Intergenic
1203552225 Un_KI270743v1:172347-172369 GAGAGATCTGGGCCGCCCCAGGG - Intergenic
1197749859 X:129957092-129957114 GAGAGCTCGGGTCTGGGCCGGGG + Intergenic
1200224854 X:154411794-154411816 CAGCGCCCCGGGCCGGCCTGTGG - Exonic