ID: 912576298

View in Genome Browser
Species Human (GRCh38)
Location 1:110675124-110675146
Sequence GGGCTCTTTCGCTGACACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912576298_912576303 4 Left 912576298 1:110675124-110675146 CCTCGGTGTCAGCGAAAGAGCCC 0: 1
1: 0
2: 0
3: 4
4: 152
Right 912576303 1:110675151-110675173 GTTGTACCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 14
912576298_912576308 26 Left 912576298 1:110675124-110675146 CCTCGGTGTCAGCGAAAGAGCCC 0: 1
1: 0
2: 0
3: 4
4: 152
Right 912576308 1:110675173-110675195 GAATGCCCACCCAGCAGAGCCGG 0: 1
1: 0
2: 2
3: 10
4: 151
912576298_912576299 -7 Left 912576298 1:110675124-110675146 CCTCGGTGTCAGCGAAAGAGCCC 0: 1
1: 0
2: 0
3: 4
4: 152
Right 912576299 1:110675140-110675162 AGAGCCCTCATGTTGTACCTCGG 0: 1
1: 1
2: 1
3: 15
4: 130
912576298_912576302 3 Left 912576298 1:110675124-110675146 CCTCGGTGTCAGCGAAAGAGCCC 0: 1
1: 0
2: 0
3: 4
4: 152
Right 912576302 1:110675150-110675172 TGTTGTACCTCGGCGCCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912576298 Original CRISPR GGGCTCTTTCGCTGACACCG AGG (reversed) Intergenic
900372867 1:2340030-2340052 GGGCTCTGCCGCTGACATCAGGG + Intronic
901121554 1:6898525-6898547 GGGCTCTTGCTCTGTCACCCAGG - Intronic
901501301 1:9654043-9654065 GGGCTCTTGCTCTGTCACCCAGG - Exonic
902480995 1:16711562-16711584 AGGCTCTTGCTCTGACACCCAGG - Intergenic
903177408 1:21589286-21589308 GGGCTCTTTCCCGGACAGCTGGG + Intergenic
903281340 1:22251684-22251706 GTGCTCTTTCCCTGACATCATGG - Intergenic
905762056 1:40567176-40567198 AGGCTCTTTCCCTGTCACCTAGG + Intergenic
906354136 1:45088983-45089005 GGGGTCTTGCTCTGCCACCGAGG + Intronic
907755952 1:57310968-57310990 GGGCTCTTGCTCTGTCACCTAGG - Intronic
908159317 1:61391084-61391106 GGTCTCTCTCTCTGACACCCAGG + Intronic
908697887 1:66865396-66865418 GGGGTCTTGCTCTGACACCCAGG - Intronic
911059763 1:93737856-93737878 GGGCTCTTGCTCTGTCACCCAGG + Intronic
912576298 1:110675124-110675146 GGGCTCTTTCGCTGACACCGAGG - Intergenic
913653182 1:120937872-120937894 GGGGTCTTACTCTGACACCCAGG + Intergenic
914167922 1:145191167-145191189 GGGGTCTTACTCTGACACCCAGG - Intergenic
914518871 1:148397960-148397982 GGGGTCTTACTCTGACACCCAGG + Intergenic
914643363 1:149632027-149632049 GGGGTCTTACTCTGACACCCAGG + Intergenic
922305883 1:224344192-224344214 GGGGTCTTTCTCTGTCACCCAGG + Intergenic
922929299 1:229376427-229376449 AGGCTCTTTCACTGAGAGCGAGG + Intergenic
924121911 1:240808847-240808869 GGGATCTTTCTCTGACACCCAGG - Intronic
1064127249 10:12673969-12673991 GGGCTCTCTCTCTGTCACCCAGG + Intronic
1065048140 10:21762633-21762655 GGGCTCTTGCTCTGTCACCCAGG + Intronic
1065212430 10:23417141-23417163 AGGGTCTTTCTCTGCCACCGAGG - Intergenic
1065587711 10:27236086-27236108 AGGGTCTTTCTCTGTCACCGAGG - Intronic
1066445730 10:35480938-35480960 GGGGTCTTGCGCTGTCACCCAGG - Intronic
1069072370 10:64002537-64002559 GAGCTTTTTGGCTGAGACCGTGG + Intergenic
1069656404 10:70092405-70092427 AGGGTCTTGCGCTGTCACCGAGG - Intronic
1070712265 10:78691401-78691423 GGGCTGTTTCCCTGGCACCAAGG + Intergenic
1072253523 10:93600450-93600472 GGGCACCTTCACAGACACCGAGG - Exonic
1072533482 10:96341560-96341582 GGGCCTTTTCTCTGACACCATGG - Intergenic
1080673291 11:34400976-34400998 AGGGTCTTTCTCTGACACCCAGG - Intergenic
1081091277 11:38868808-38868830 GGGATCTTTCTCTGTCACCTAGG + Intergenic
1083663764 11:64263980-64264002 GGGCTCTGTCTCTGAGACCTTGG + Intronic
1084969515 11:72763042-72763064 GGGCTCTTCCCCTGGCACAGTGG + Intronic
1085534285 11:77208751-77208773 GGGATCCTTCCCTGGCACCGTGG - Exonic
1085919257 11:80932159-80932181 GGGGTCTTTCTCTGTCACCCAGG - Intergenic
1091053298 11:132394662-132394684 AGGCTCCTTCGCTGCCACTGTGG - Intergenic
1091233568 11:134003580-134003602 GGTCTCTGTCGTTGACACTGTGG - Intergenic
1094627218 12:32135424-32135446 GGTCTCTTGCGCTGTCACCTAGG + Intronic
1100514283 12:95311935-95311957 GGGCTCTTTGCCTGGCACAGTGG - Intergenic
1101711735 12:107273811-107273833 AGGCTCTTGCTCTGACACCCAGG - Intergenic
1102834946 12:116047324-116047346 AGGCTCTTTCTCTGTCACCCAGG - Intronic
1102858713 12:116317131-116317153 GGGGTCTTACTCTGTCACCGGGG - Intergenic
1104940145 12:132391397-132391419 GGGGTCTTTTGCTGTCACCTTGG - Intergenic
1106107913 13:26750292-26750314 GGGGTCTTGCTCTGACACCCAGG - Intergenic
1107423362 13:40270161-40270183 GGGGTCTTTCTCTGTCACCCAGG + Intergenic
1108157494 13:47600994-47601016 GGGGTCTTGCTCTGTCACCGAGG - Intergenic
1110266499 13:73543423-73543445 GGGGTCTTTCTCTGTCACCCAGG + Intergenic
1112310964 13:98317283-98317305 GGGGTCTTGCGCTGTCACCCAGG + Intronic
1115396009 14:32909321-32909343 GGGGTCTTTCTCTGTCACTGAGG - Intergenic
1116845143 14:49858287-49858309 GGGGTCTTTCTCTGTCACCCAGG - Intergenic
1121012847 14:90532139-90532161 GGGGTCTTGCTCTGTCACCGAGG - Exonic
1121297439 14:92840787-92840809 GGGGTCTTGCTCTGACACCCAGG + Intergenic
1122965882 14:105125583-105125605 GGGGTCTTTCTCTGTCACCCAGG - Intergenic
1125015872 15:34934099-34934121 GGGGTCTTTCTCTGTCACCAAGG - Intronic
1126590793 15:50337739-50337761 GGGGTCTGTCTCTGACACCCAGG - Intronic
1131079389 15:89522104-89522126 AGGCTCTTTCTCTGTCACCCAGG - Intergenic
1131519240 15:93100885-93100907 GGGGTCTTTCTCTGTCACCTAGG + Intergenic
1134411762 16:14008972-14008994 GGTCTCTCTCTCTGACACCCAGG + Intergenic
1134517958 16:14902331-14902353 GGGGTCTTTCTCTGTCACCCAGG + Intronic
1134705627 16:16300986-16301008 GGGGTCTTTCTCTGTCACCCAGG + Intergenic
1134961914 16:18411128-18411150 GGGGTCTTTCTCTGTCACCCAGG - Intergenic
1134966212 16:18493727-18493749 GGGGTCTTTCTCTGTCACCCAGG - Intronic
1135556602 16:23442306-23442328 GGAGTCTTTCTCTGTCACCGAGG - Intronic
1136009421 16:27353295-27353317 GGGCTCTTGCTCTGTCACCCAGG - Intronic
1141417442 16:83887004-83887026 GGGCTCCTGCGTTGACACAGTGG - Intergenic
1142088187 16:88195697-88195719 GGGCTCTTGCTCTGAGACCTCGG + Intergenic
1142554743 17:766270-766292 GGGGTCTCTCTCTGTCACCGAGG - Intronic
1142819924 17:2457903-2457925 GGGCTCTTGCTCTGTCACCCAGG + Intronic
1143805003 17:9418947-9418969 GGGCTCTCTCCCTGTCACCCAGG + Intronic
1146025471 17:29316682-29316704 GGGGTCTTGCGCTGTCACCTAGG - Intergenic
1147714260 17:42493786-42493808 GGGGTCTTTCTCTGCCACCCAGG - Intronic
1148654412 17:49272586-49272608 GGGGTCTTTCTCTGTCACCCAGG + Intergenic
1152328162 17:79654589-79654611 GGACTCCTTCCCTTACACCGAGG - Intergenic
1154150178 18:11900319-11900341 GGAGTCTTTCTCTGTCACCGAGG - Intronic
1158627980 18:59088330-59088352 GGGCTCTTGCCCTGTCACCCAGG - Intergenic
1163670066 19:18622387-18622409 AGGGTCTTACGCTGTCACCGAGG + Intergenic
1164204380 19:23045700-23045722 GGGGTCTTGCTCTGTCACCGAGG + Intergenic
1164826776 19:31289827-31289849 GAGCTCTTTCCCTGACACAGAGG - Intronic
1166090543 19:40505898-40505920 GGGCTCTGTCTCTGTCACAGTGG - Intronic
1166479394 19:43156755-43156777 GGGGTCTTTCTCTGTCACCCAGG + Intronic
1202715032 1_KI270714v1_random:37467-37489 AGGCTCTTGCTCTGACACCCAGG - Intergenic
925030623 2:647878-647900 GGGGTCAGTCGCTGGCACCGAGG + Intergenic
925807972 2:7671462-7671484 GGCCTCTGTAGCTGGCACCGTGG - Intergenic
931278352 2:60764440-60764462 GGGCTCTTACTCTGTCACCCGGG + Intronic
931652941 2:64484676-64484698 AGGGTCTTTCGCTGTCACCCAGG - Intergenic
931696029 2:64871202-64871224 GGGCTCTTGCTCTGTCACCCAGG + Intergenic
937111139 2:119367690-119367712 GGGCTCCGGCGCTGACACCGCGG + Intronic
937686854 2:124707217-124707239 GGGATCATTCACTGACACTGAGG + Intronic
941866887 2:170344438-170344460 GGGGTCTTTCTCTGCCACCCAGG - Intronic
946170584 2:217893002-217893024 GGGCTCTTTCAGGGAAACCGAGG - Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1169355623 20:4902537-4902559 GAGCTCTCTCGCTGAGACCCTGG - Exonic
1169438535 20:5614601-5614623 GGGGTCTTGCTCTGTCACCGAGG + Intergenic
1170041529 20:12044875-12044897 GGGTTCTTTCTCTGTCACCCAGG + Intergenic
1170211041 20:13846486-13846508 GGGGTCTTTCTCTGTCACCCAGG - Intergenic
1171471097 20:25372025-25372047 GGGATCTTTCTCTGTCACCTAGG + Intronic
1172875336 20:38160709-38160731 GGGCTTTTTCTCTGCCACCCAGG + Intronic
1173230775 20:41195142-41195164 GGGGTCTTACGCTGTCACCCAGG + Intronic
1175664778 20:60849291-60849313 GAGCTCTTTCTCTGACACCCTGG + Intergenic
1178368992 21:32011503-32011525 GCCCTCTTTTGCTGTCACCGGGG + Intronic
1178457762 21:32771518-32771540 GGGCCCTGTCGCCGCCACCGGGG + Exonic
1181074393 22:20365863-20365885 GGGGTCTTGCGCTGTCACCCAGG + Intronic
1182068382 22:27446029-27446051 GGCCTCCTTGGCTGACCCCGTGG - Intergenic
1182268968 22:29141379-29141401 GGGCTCTCTTGCTGCCACAGGGG - Intronic
1183751132 22:39721237-39721259 GGGCTCTCCTGCTGACACCTGGG + Intergenic
1183780042 22:39993804-39993826 GAGGTCTTTCGCTGACATCACGG - Intergenic
950378983 3:12595091-12595113 TGGCTCTTGCTCTGTCACCGAGG + Intronic
954200098 3:49018795-49018817 GGGTTCTTTCGCTGTGACCCAGG + Intronic
959062840 3:101631829-101631851 GGGCTCTTGCTCTGTCACCCCGG - Intergenic
961235449 3:125362578-125362600 GGGCTCTTACTCTGTCACCCAGG + Intronic
961530905 3:127539843-127539865 GGGCTCTTGCGTTGATACTGTGG + Intergenic
967447101 3:189579399-189579421 GGTCCCTTTTGCTGACACTGTGG - Intergenic
968893770 4:3386589-3386611 GGGCGCTTTCTGTGACACCCAGG + Intronic
969417204 4:7068440-7068462 CCGCCCTTGCGCTGACACCGCGG + Intergenic
969881966 4:10182058-10182080 TGGCTCTTTCCCTGTCACTGAGG + Intergenic
972358826 4:38307451-38307473 AGGGTCTTTCTCTGTCACCGAGG - Intergenic
973624174 4:52754519-52754541 GGGATCTTGCTCTGTCACCGAGG - Intergenic
979187975 4:117822672-117822694 GGGGTCTTTCTCTGTCACCCAGG - Intergenic
980771574 4:137379935-137379957 GGGCTCTATTGCTGACACATTGG - Intergenic
988522254 5:31956914-31956936 GGGGTCTTTCTCTGTCACCCAGG + Intronic
991389477 5:66126775-66126797 GGGCTCTTGCTCTGTCACCCAGG - Intergenic
993526134 5:88968004-88968026 GGGCTCTTTAGATGACATCTGGG - Intergenic
999522171 5:152362018-152362040 GGGGTCTTTCTCTGTCACCCAGG + Intergenic
1000080522 5:157841238-157841260 GGGCTCTTGCTCTGTCACCCAGG - Intronic
1005956779 6:30669697-30669719 GGGGTCTTGCCCTGTCACCGAGG - Intronic
1008613488 6:53205228-53205250 AGGGTCTTTCTCTGACACCCAGG + Intergenic
1013306932 6:108856780-108856802 GGGCTCTTTCGCTGAGGTGGAGG - Intronic
1015421067 6:133009249-133009271 GGGGTCTTTCTCTGTCACCCAGG + Intergenic
1020066887 7:5195174-5195196 GGGCTCTTTCATTGACAAAGGGG - Intronic
1020709055 7:11583300-11583322 AGGGTCTTTCTCTGCCACCGAGG + Intronic
1022816743 7:33921528-33921550 GGTCTCTCTCACTGACCCCGGGG - Intronic
1022863371 7:34391370-34391392 GGACTCTTTCTCTGTCACCCAGG + Intergenic
1023959888 7:44917479-44917501 GGGCTCTTGCCCTGTCACCTAGG + Intergenic
1026395227 7:69945871-69945893 GGGCTCTTACTCTGTCACCCAGG + Intronic
1033350982 7:140561913-140561935 GGACTCTTGCTCTGTCACCGAGG + Intronic
1037269448 8:17110587-17110609 GGGGTCTTTCTCTGCCACCCAGG + Intronic
1038730235 8:30120554-30120576 GGGTTCTTTCTCTGTCACCCAGG + Intronic
1039067473 8:33621560-33621582 GGGGTCTTTCTCTGTCACCCAGG + Intergenic
1039738725 8:40359988-40360010 GGGGTCTTGCTCTGACACCAAGG - Intergenic
1040318628 8:46277824-46277846 GGGCTCTTGCCATGACACGGGGG + Intergenic
1041249054 8:55917209-55917231 GGGATCTTGCGCTGTCACCCAGG + Intronic
1043546363 8:81320256-81320278 GGGGTCTTTCTCTGTCACCCAGG - Intergenic
1057388106 9:94622044-94622066 GGGCTCTCTTGGTGACACCCTGG + Intronic
1060384772 9:123215090-123215112 GGGCTCTTACTCTGTCACCCAGG + Intronic
1060830195 9:126708914-126708936 GGGGTCTTTCTCTGTCACCTAGG - Intergenic
1061656449 9:132094913-132094935 GGGCTCTTGGACTTACACCGTGG - Intergenic
1061893111 9:133633224-133633246 GGGCTTATTTCCTGACACCGTGG + Intergenic
1062310872 9:135936153-135936175 AGGCTCTTTCTCTGTCACCCAGG - Intronic
1062648771 9:137564839-137564861 CGTCTCTTTCGCTGTCCCCGGGG - Intronic
1186140910 X:6572540-6572562 GGGGTCTTTCTCTGTCACCCAGG - Intergenic
1186327211 X:8493017-8493039 GGGCTCTTGCTCTGTCACCCAGG + Intergenic
1187524912 X:20045499-20045521 GGGGTCTTTCTCTGTCACCCAGG - Intronic
1189249853 X:39592314-39592336 GGCCTCTCTCCCTGACACTGGGG + Intergenic
1190242559 X:48668728-48668750 GGACTCCTTCCCTGACACCCTGG - Intergenic
1193728172 X:85068429-85068451 GGGGTCTTTCTCTGTCACCCAGG + Intronic
1195268487 X:103207558-103207580 GGGGTCTTTCTCTGTCACCCAGG + Intergenic