ID: 912577642

View in Genome Browser
Species Human (GRCh38)
Location 1:110688425-110688447
Sequence TTGGCAGAAATTGGGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912577642_912577646 27 Left 912577642 1:110688425-110688447 CCAGTCAGCCCAATTTCTGCCAA No data
Right 912577646 1:110688475-110688497 TTTGAAGACAGAAGACATGTTGG No data
912577642_912577647 28 Left 912577642 1:110688425-110688447 CCAGTCAGCCCAATTTCTGCCAA No data
Right 912577647 1:110688476-110688498 TTGAAGACAGAAGACATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912577642 Original CRISPR TTGGCAGAAATTGGGCTGAC TGG (reversed) Intergenic
No off target data available for this crispr