ID: 912578921

View in Genome Browser
Species Human (GRCh38)
Location 1:110703012-110703034
Sequence ATGTATTTGAATAATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912578921_912578923 13 Left 912578921 1:110703012-110703034 CCCTCTTCATTATTCAAATACAT No data
Right 912578923 1:110703048-110703070 AATATGTTCTACTATTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912578921 Original CRISPR ATGTATTTGAATAATGAAGA GGG (reversed) Intergenic
No off target data available for this crispr