ID: 912579603

View in Genome Browser
Species Human (GRCh38)
Location 1:110708239-110708261
Sequence TTAATTCAGAAAATATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912579599_912579603 -8 Left 912579599 1:110708224-110708246 CCCCACATTGCCTCATTAATTCA No data
Right 912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG No data
912579597_912579603 -6 Left 912579597 1:110708222-110708244 CCCCCCACATTGCCTCATTAATT No data
Right 912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG No data
912579596_912579603 -3 Left 912579596 1:110708219-110708241 CCTCCCCCCACATTGCCTCATTA No data
Right 912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG No data
912579600_912579603 -9 Left 912579600 1:110708225-110708247 CCCACATTGCCTCATTAATTCAG No data
Right 912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG No data
912579601_912579603 -10 Left 912579601 1:110708226-110708248 CCACATTGCCTCATTAATTCAGA No data
Right 912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG No data
912579598_912579603 -7 Left 912579598 1:110708223-110708245 CCCCCACATTGCCTCATTAATTC No data
Right 912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912579603 Original CRISPR TTAATTCAGAAAATATTTAT TGG Intergenic
No off target data available for this crispr