ID: 912581112

View in Genome Browser
Species Human (GRCh38)
Location 1:110721817-110721839
Sequence TGATGCTAATAGACTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912581109_912581112 2 Left 912581109 1:110721792-110721814 CCCAGAGAGGCACAGTGCTTCGG No data
Right 912581112 1:110721817-110721839 TGATGCTAATAGACTGATTTTGG No data
912581111_912581112 1 Left 912581111 1:110721793-110721815 CCAGAGAGGCACAGTGCTTCGGC No data
Right 912581112 1:110721817-110721839 TGATGCTAATAGACTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912581112 Original CRISPR TGATGCTAATAGACTGATTT TGG Intergenic
No off target data available for this crispr