ID: 912581595

View in Genome Browser
Species Human (GRCh38)
Location 1:110725864-110725886
Sequence ATGTTGTTCTAGGTGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912581595_912581600 2 Left 912581595 1:110725864-110725886 CCTTGCAGCACCTAGAACAACAT No data
Right 912581600 1:110725889-110725911 TGTGGCTGGCAGTAAATAGGTGG No data
912581595_912581601 3 Left 912581595 1:110725864-110725886 CCTTGCAGCACCTAGAACAACAT No data
Right 912581601 1:110725890-110725912 GTGGCTGGCAGTAAATAGGTGGG No data
912581595_912581599 -1 Left 912581595 1:110725864-110725886 CCTTGCAGCACCTAGAACAACAT No data
Right 912581599 1:110725886-110725908 TCTTGTGGCTGGCAGTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912581595 Original CRISPR ATGTTGTTCTAGGTGCTGCA AGG (reversed) Intergenic
No off target data available for this crispr