ID: 912583186

View in Genome Browser
Species Human (GRCh38)
Location 1:110738125-110738147
Sequence CCTCACCTGCAGGAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912583186_912583193 14 Left 912583186 1:110738125-110738147 CCTCCCATCTCCTGCAGGTGAGG No data
Right 912583193 1:110738162-110738184 CTGCTCTGCAGTTTCCCCACAGG No data
912583186_912583195 20 Left 912583186 1:110738125-110738147 CCTCCCATCTCCTGCAGGTGAGG No data
Right 912583195 1:110738168-110738190 TGCAGTTTCCCCACAGGGCCAGG No data
912583186_912583200 30 Left 912583186 1:110738125-110738147 CCTCCCATCTCCTGCAGGTGAGG No data
Right 912583200 1:110738178-110738200 CCACAGGGCCAGGTGCCAGTGGG No data
912583186_912583194 15 Left 912583186 1:110738125-110738147 CCTCCCATCTCCTGCAGGTGAGG No data
Right 912583194 1:110738163-110738185 TGCTCTGCAGTTTCCCCACAGGG No data
912583186_912583198 29 Left 912583186 1:110738125-110738147 CCTCCCATCTCCTGCAGGTGAGG No data
Right 912583198 1:110738177-110738199 CCCACAGGGCCAGGTGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912583186 Original CRISPR CCTCACCTGCAGGAGATGGG AGG (reversed) Intergenic
No off target data available for this crispr