ID: 912583230

View in Genome Browser
Species Human (GRCh38)
Location 1:110738370-110738392
Sequence CATCCTGCCCAGAGGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912583224_912583230 10 Left 912583224 1:110738337-110738359 CCTGTTTGTGCTCTCTTAGGGTT No data
Right 912583230 1:110738370-110738392 CATCCTGCCCAGAGGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912583230 Original CRISPR CATCCTGCCCAGAGGGCACC TGG Intergenic
No off target data available for this crispr