ID: 912585256

View in Genome Browser
Species Human (GRCh38)
Location 1:110757975-110757997
Sequence GTTTTAAGGAGACTCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912585256_912585263 28 Left 912585256 1:110757975-110757997 CCACCTCTGAGTCTCCTTAAAAC No data
Right 912585263 1:110758026-110758048 GTTTCTTGTCAAGACTAACTAGG No data
912585256_912585264 29 Left 912585256 1:110757975-110757997 CCACCTCTGAGTCTCCTTAAAAC No data
Right 912585264 1:110758027-110758049 TTTCTTGTCAAGACTAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912585256 Original CRISPR GTTTTAAGGAGACTCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr