ID: 912594038

View in Genome Browser
Species Human (GRCh38)
Location 1:110856372-110856394
Sequence AGTACTGGAGATATTGTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912594038_912594048 23 Left 912594038 1:110856372-110856394 CCTATGACAATATCTCCAGTACT No data
Right 912594048 1:110856418-110856440 GTAGGCTCAGTTGGAAGTTAGGG No data
912594038_912594045 14 Left 912594038 1:110856372-110856394 CCTATGACAATATCTCCAGTACT No data
Right 912594045 1:110856409-110856431 GCCACAGTGGTAGGCTCAGTTGG No data
912594038_912594047 22 Left 912594038 1:110856372-110856394 CCTATGACAATATCTCCAGTACT No data
Right 912594047 1:110856417-110856439 GGTAGGCTCAGTTGGAAGTTAGG No data
912594038_912594041 1 Left 912594038 1:110856372-110856394 CCTATGACAATATCTCCAGTACT No data
Right 912594041 1:110856396-110856418 CATCTCCTCCGCTGCCACAGTGG No data
912594038_912594042 5 Left 912594038 1:110856372-110856394 CCTATGACAATATCTCCAGTACT No data
Right 912594042 1:110856400-110856422 TCCTCCGCTGCCACAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912594038 Original CRISPR AGTACTGGAGATATTGTCAT AGG (reversed) Intergenic
No off target data available for this crispr