ID: 912594039

View in Genome Browser
Species Human (GRCh38)
Location 1:110856387-110856409
Sequence CAGCGGAGGAGATGGAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912594039_912594045 -1 Left 912594039 1:110856387-110856409 CCAGTACTCCATCTCCTCCGCTG No data
Right 912594045 1:110856409-110856431 GCCACAGTGGTAGGCTCAGTTGG No data
912594039_912594047 7 Left 912594039 1:110856387-110856409 CCAGTACTCCATCTCCTCCGCTG No data
Right 912594047 1:110856417-110856439 GGTAGGCTCAGTTGGAAGTTAGG No data
912594039_912594042 -10 Left 912594039 1:110856387-110856409 CCAGTACTCCATCTCCTCCGCTG No data
Right 912594042 1:110856400-110856422 TCCTCCGCTGCCACAGTGGTAGG No data
912594039_912594048 8 Left 912594039 1:110856387-110856409 CCAGTACTCCATCTCCTCCGCTG No data
Right 912594048 1:110856418-110856440 GTAGGCTCAGTTGGAAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912594039 Original CRISPR CAGCGGAGGAGATGGAGTAC TGG (reversed) Intergenic
No off target data available for this crispr