ID: 912594040 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:110856395-110856417 |
| Sequence | CACTGTGGCAGCGGAGGAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912594040_912594047 | -1 | Left | 912594040 | 1:110856395-110856417 | CCATCTCCTCCGCTGCCACAGTG | No data | ||
| Right | 912594047 | 1:110856417-110856439 | GGTAGGCTCAGTTGGAAGTTAGG | No data | ||||
| 912594040_912594045 | -9 | Left | 912594040 | 1:110856395-110856417 | CCATCTCCTCCGCTGCCACAGTG | No data | ||
| Right | 912594045 | 1:110856409-110856431 | GCCACAGTGGTAGGCTCAGTTGG | No data | ||||
| 912594040_912594048 | 0 | Left | 912594040 | 1:110856395-110856417 | CCATCTCCTCCGCTGCCACAGTG | No data | ||
| Right | 912594048 | 1:110856418-110856440 | GTAGGCTCAGTTGGAAGTTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912594040 | Original CRISPR | CACTGTGGCAGCGGAGGAGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||