ID: 912594040

View in Genome Browser
Species Human (GRCh38)
Location 1:110856395-110856417
Sequence CACTGTGGCAGCGGAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912594040_912594047 -1 Left 912594040 1:110856395-110856417 CCATCTCCTCCGCTGCCACAGTG No data
Right 912594047 1:110856417-110856439 GGTAGGCTCAGTTGGAAGTTAGG No data
912594040_912594045 -9 Left 912594040 1:110856395-110856417 CCATCTCCTCCGCTGCCACAGTG No data
Right 912594045 1:110856409-110856431 GCCACAGTGGTAGGCTCAGTTGG No data
912594040_912594048 0 Left 912594040 1:110856395-110856417 CCATCTCCTCCGCTGCCACAGTG No data
Right 912594048 1:110856418-110856440 GTAGGCTCAGTTGGAAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912594040 Original CRISPR CACTGTGGCAGCGGAGGAGA TGG (reversed) Intergenic
No off target data available for this crispr