ID: 912594044

View in Genome Browser
Species Human (GRCh38)
Location 1:110856404-110856426
Sequence TGAGCCTACCACTGTGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912594044_912594047 -10 Left 912594044 1:110856404-110856426 CCGCTGCCACAGTGGTAGGCTCA No data
Right 912594047 1:110856417-110856439 GGTAGGCTCAGTTGGAAGTTAGG No data
912594044_912594049 29 Left 912594044 1:110856404-110856426 CCGCTGCCACAGTGGTAGGCTCA No data
Right 912594049 1:110856456-110856478 GAGTGCCACCTCTTCCTACCAGG No data
912594044_912594048 -9 Left 912594044 1:110856404-110856426 CCGCTGCCACAGTGGTAGGCTCA No data
Right 912594048 1:110856418-110856440 GTAGGCTCAGTTGGAAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912594044 Original CRISPR TGAGCCTACCACTGTGGCAG CGG (reversed) Intergenic
No off target data available for this crispr