ID: 912594045

View in Genome Browser
Species Human (GRCh38)
Location 1:110856409-110856431
Sequence GCCACAGTGGTAGGCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912594039_912594045 -1 Left 912594039 1:110856387-110856409 CCAGTACTCCATCTCCTCCGCTG No data
Right 912594045 1:110856409-110856431 GCCACAGTGGTAGGCTCAGTTGG No data
912594038_912594045 14 Left 912594038 1:110856372-110856394 CCTATGACAATATCTCCAGTACT No data
Right 912594045 1:110856409-110856431 GCCACAGTGGTAGGCTCAGTTGG No data
912594040_912594045 -9 Left 912594040 1:110856395-110856417 CCATCTCCTCCGCTGCCACAGTG No data
Right 912594045 1:110856409-110856431 GCCACAGTGGTAGGCTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912594045 Original CRISPR GCCACAGTGGTAGGCTCAGT TGG Intergenic
No off target data available for this crispr