ID: 912594048

View in Genome Browser
Species Human (GRCh38)
Location 1:110856418-110856440
Sequence GTAGGCTCAGTTGGAAGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912594044_912594048 -9 Left 912594044 1:110856404-110856426 CCGCTGCCACAGTGGTAGGCTCA No data
Right 912594048 1:110856418-110856440 GTAGGCTCAGTTGGAAGTTAGGG No data
912594040_912594048 0 Left 912594040 1:110856395-110856417 CCATCTCCTCCGCTGCCACAGTG No data
Right 912594048 1:110856418-110856440 GTAGGCTCAGTTGGAAGTTAGGG No data
912594039_912594048 8 Left 912594039 1:110856387-110856409 CCAGTACTCCATCTCCTCCGCTG No data
Right 912594048 1:110856418-110856440 GTAGGCTCAGTTGGAAGTTAGGG No data
912594043_912594048 -6 Left 912594043 1:110856401-110856423 CCTCCGCTGCCACAGTGGTAGGC No data
Right 912594048 1:110856418-110856440 GTAGGCTCAGTTGGAAGTTAGGG No data
912594038_912594048 23 Left 912594038 1:110856372-110856394 CCTATGACAATATCTCCAGTACT No data
Right 912594048 1:110856418-110856440 GTAGGCTCAGTTGGAAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912594048 Original CRISPR GTAGGCTCAGTTGGAAGTTA GGG Intergenic
No off target data available for this crispr