ID: 912595372

View in Genome Browser
Species Human (GRCh38)
Location 1:110870807-110870829
Sequence CTGTGTTACTCTGTGTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912595372_912595377 24 Left 912595372 1:110870807-110870829 CCAACATACACAGAGTAACACAG 0: 1
1: 0
2: 0
3: 23
4: 334
Right 912595377 1:110870854-110870876 GGGGAAAACAATGAAAAACAAGG 0: 1
1: 0
2: 5
3: 69
4: 743
912595372_912595374 3 Left 912595372 1:110870807-110870829 CCAACATACACAGAGTAACACAG 0: 1
1: 0
2: 0
3: 23
4: 334
Right 912595374 1:110870833-110870855 CTACAGAGCTTTCAGTCTAGTGG 0: 1
1: 1
2: 3
3: 38
4: 299
912595372_912595375 4 Left 912595372 1:110870807-110870829 CCAACATACACAGAGTAACACAG 0: 1
1: 0
2: 0
3: 23
4: 334
Right 912595375 1:110870834-110870856 TACAGAGCTTTCAGTCTAGTGGG 0: 1
1: 1
2: 9
3: 99
4: 566
912595372_912595376 5 Left 912595372 1:110870807-110870829 CCAACATACACAGAGTAACACAG 0: 1
1: 0
2: 0
3: 23
4: 334
Right 912595376 1:110870835-110870857 ACAGAGCTTTCAGTCTAGTGGGG 0: 1
1: 2
2: 23
3: 173
4: 752

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912595372 Original CRISPR CTGTGTTACTCTGTGTATGT TGG (reversed) Intergenic
900094595 1:935091-935113 CTCTGGGACTCTGTGGATGTGGG + Intronic
900340364 1:2185916-2185938 CTGTGTTTCTGGGTGTTTGTAGG - Intronic
900972908 1:6001336-6001358 CTGTGTGTCTGTGTGTGTGTTGG - Intronic
903017653 1:20371661-20371683 CTTGGTCACTCTGCGTATGTGGG + Intergenic
903159226 1:21473074-21473096 TTGTGTTTCTCTGTGTGTGGTGG + Intronic
903383315 1:22911322-22911344 GTGTGTTCATCTGTGCATGTAGG - Intronic
903882510 1:26521141-26521163 CTGTGTGACTTTGAGTATTTCGG - Intergenic
904123598 1:28220146-28220168 GTGTGTTTGTATGTGTATGTAGG - Intronic
905174458 1:36127055-36127077 GTGTGTGGCTCTGTGTTTGTGGG + Intergenic
905713025 1:40123502-40123524 AGGTGTTAGTCTGTTTATGTGGG + Intergenic
906077017 1:43059155-43059177 CTGTGTGACTGTCTGTATCTTGG + Intergenic
906524648 1:46487201-46487223 CTGTGTGTCTCTGTGAAGGTGGG + Intergenic
906607114 1:47180332-47180354 ATGTGTCACTCTGAGTATGACGG + Intergenic
907537348 1:55176336-55176358 CTGTGATATTTTGTGTGTGTCGG - Intronic
907820041 1:57958310-57958332 CTGTGATACACTGGGTAAGTTGG + Intronic
907849931 1:58246824-58246846 GTGTGTGACTCTGTGTGTGAAGG + Intronic
908123619 1:61008523-61008545 CTGTGGCACTCTGTGTCTGTGGG - Intronic
908312008 1:62893853-62893875 ATGTGATACTCTGTGTCTTTTGG - Intergenic
908873885 1:68647627-68647649 CTGTGTTACCCTGTGAGTCTGGG + Intergenic
909129619 1:71718038-71718060 CTGTGATACTCTGTTTTGGTAGG + Intronic
910004197 1:82375408-82375430 CTGTGTCTCTGTGTGTCTGTGGG + Intergenic
912595372 1:110870807-110870829 CTGTGTTACTCTGTGTATGTTGG - Intergenic
915755727 1:158257408-158257430 CTGTGATGCTCTGTGAATTTGGG - Exonic
915788879 1:158646110-158646132 CTGTGTGTGTATGTGTATGTTGG - Intronic
916564166 1:165958735-165958757 CTGTGTTACTCTCTGCTTTTTGG + Intergenic
916728853 1:167548652-167548674 TTGTGTTACTTTTTGAATGTGGG - Intronic
916745641 1:167683017-167683039 CTGACTTACTCTGTGTGTCTTGG + Intronic
917665481 1:177221681-177221703 ATGTGGTAGTGTGTGTATGTGGG - Intronic
919553228 1:199018963-199018985 CTGTCATCCTTTGTGTATGTAGG + Intergenic
919745649 1:201007407-201007429 CTGTGTATCTCTGTGTGTGTGGG - Intronic
919892492 1:201985604-201985626 CTGTGTGTATATGTGTATGTAGG - Intronic
924877810 1:248124950-248124972 CTGTTTAATTCTGTTTATGTGGG + Intergenic
924894490 1:248321097-248321119 CTGTTTAATTCTGTTTATGTGGG - Intergenic
1065897130 10:30173398-30173420 CTGTGTGGTTCTGTGTAGGTGGG - Intergenic
1066550545 10:36551947-36551969 CTTTGTAAGTCTGTGTGTGTGGG - Intergenic
1067800121 10:49353038-49353060 CTGTGTCACCATGTGTATGAGGG - Intergenic
1068358901 10:55950093-55950115 CTGTGTTTCTGTGTGTATGAAGG + Intergenic
1068895265 10:62191875-62191897 CTAAGTTACTGTGTGTGTGTTGG + Intronic
1069746142 10:70716248-70716270 CTGGGTTGCCCTGTGAATGTGGG + Intronic
1070315051 10:75302317-75302339 CAGTTTTACTCTGTGGATCTAGG + Intergenic
1070816334 10:79326830-79326852 GTGTGTGTGTCTGTGTATGTGGG + Intergenic
1074080567 10:110165173-110165195 CTGTGTGACTCTGGGTAAGTGGG + Intergenic
1074600821 10:114911575-114911597 CTCTGTCACTCTGTGTCTCTGGG + Intergenic
1074869111 10:117563220-117563242 ATGTGTGTCTCTGGGTATGTTGG + Intergenic
1074869125 10:117563340-117563362 GTGTGTGTCTGTGTGTATGTGGG + Intergenic
1075875061 10:125799391-125799413 CTGTGTGTCTATGTGTGTGTTGG + Intronic
1075904914 10:126072684-126072706 GTGAGACACTCTGTGTATGTTGG - Intronic
1076138314 10:128060121-128060143 CTGTGTGAATGTGTGCATGTGGG - Intronic
1077512037 11:2971834-2971856 CTGTGTTCCTCTCTCTGTGTAGG + Intronic
1079214031 11:18490277-18490299 CAGTGTTACTCTGTGGACATCGG - Intronic
1079339384 11:19599403-19599425 CTGGGCTACTCTGTGTTTGGAGG + Intronic
1080931776 11:36818751-36818773 ATGTTTTACCCTGTGTCTGTTGG + Intergenic
1081135440 11:39434494-39434516 CTGAGTTTCTCTGTGGCTGTGGG - Intergenic
1081866523 11:46363405-46363427 CTGTGTGACTGTGTGCAAGTTGG - Intronic
1085057118 11:73411486-73411508 CAGTGTTACTCTGGGTCGGTGGG + Exonic
1085591881 11:77770637-77770659 GTGTGTTTCTTTATGTATGTGGG - Intronic
1086687680 11:89751294-89751316 CTTTGTTTCTCTATCTATGTTGG + Intergenic
1086718172 11:90088601-90088623 CTTTGTTTCTCTATCTATGTTGG - Intergenic
1087285378 11:96259666-96259688 CTGACTTACTTTGTGTTTGTTGG - Intronic
1087289216 11:96301190-96301212 GTGTATTTCTCTGTGTATGTGGG - Intronic
1087333888 11:96818277-96818299 TTGTATTACTTTGTGTAAGTGGG + Intergenic
1087502259 11:98972667-98972689 ATGTCTTACTCTGTGTAAGTGGG + Intergenic
1087692321 11:101335762-101335784 CTGGGTTTCTCTTTGTCTGTGGG + Intergenic
1087964029 11:104390347-104390369 GTGTGTGAGTGTGTGTATGTAGG + Intergenic
1088002412 11:104898284-104898306 CTATTTTACTCTGGGTATGGAGG - Intergenic
1088057857 11:105607364-105607386 CTGAGTTGCTATGTGTTTGTAGG - Intergenic
1089323696 11:117643333-117643355 GTGTGTTTGTGTGTGTATGTGGG + Intronic
1089826988 11:121286923-121286945 CTGTGTTACTTTTTGTGTGGTGG - Intergenic
1091986040 12:4910757-4910779 CTGTGTTCTTCGGTGTCTGTAGG + Intronic
1093716577 12:22390089-22390111 CTGTGTGTATCTGTGTATGAGGG - Intronic
1097574476 12:61374080-61374102 CTGTGTTTCTCTGTATCTTTTGG - Intergenic
1099687019 12:85903195-85903217 CTGTGTGACTCTTTGAATTTTGG - Intergenic
1099994510 12:89763828-89763850 CTCTGTAACTTTGTGTGTGTAGG - Intergenic
1100443079 12:94635638-94635660 CTGTTTTTGTGTGTGTATGTGGG + Intronic
1101197449 12:102399137-102399159 GTGTGTGTGTCTGTGTATGTAGG + Intronic
1102807310 12:115793340-115793362 CTATGTTGCTCTGTAAATGTGGG - Intergenic
1104389865 12:128382922-128382944 GTGTGTGAATCTGTGTATGTGGG + Intronic
1104905944 12:132213574-132213596 GTGTGTGACTGTGTGTAGGTGGG - Intronic
1106861723 13:33916654-33916676 CTGTGTGTCTGTGTATATGTAGG + Intronic
1108773601 13:53735403-53735425 TTGTGTTACTCTGGATATTTAGG - Intergenic
1109535665 13:63715091-63715113 CTGTTTTATTCTGTGAATTTAGG + Intergenic
1109637524 13:65142105-65142127 GTTTGTTTCTCAGTGTATGTTGG - Intergenic
1111356410 13:87109636-87109658 CTGTGTTTGTGTGTGTATGTGGG + Intergenic
1113433650 13:110271610-110271632 CAGTCTTTCTGTGTGTATGTGGG - Intronic
1113439538 13:110317337-110317359 ATGTGTTTCTGTGTGTGTGTGGG - Intronic
1115435320 14:33365399-33365421 CAGTACTACTGTGTGTATGTGGG - Intronic
1115729249 14:36250294-36250316 CTGAGGGACTCTGTGCATGTTGG - Intergenic
1115788387 14:36852218-36852240 CTGTTGTTCTCTGTGTAGGTAGG - Intronic
1117113147 14:52479851-52479873 CAGTCTTACTTTGGGTATGTGGG - Intronic
1117171095 14:53097844-53097866 CTTTGTTTCTCTGTGTATAGGGG - Intronic
1121406846 14:93724384-93724406 CTGTGCTACCTTGTTTATGTCGG + Intronic
1122207205 14:100153756-100153778 CTGTGTGGGTCTGTGTATCTTGG - Intronic
1122986763 14:105215226-105215248 CTGTGTTTCTCTGTGTGCGTGGG - Intronic
1128534642 15:68481414-68481436 CTGTCTTTCTCTATGTATCTGGG + Intergenic
1129065282 15:72898185-72898207 CTGTGTTACCTTTTGAATGTAGG + Intergenic
1129453500 15:75663679-75663701 CTGTGCTATCCTGTATATGTTGG - Intergenic
1129649526 15:77472685-77472707 CTGTGTTTCTGTGTGTGTATGGG + Intronic
1130797065 15:87221033-87221055 CTGGGTTTCTCTCTGGATGTTGG - Intergenic
1131930222 15:97433053-97433075 CAGTGTGACTCTGTGAGTGTAGG - Intergenic
1133385610 16:5367788-5367810 CTGTGTTACTTTCTGGATGTGGG - Intergenic
1133769226 16:8858179-8858201 CTGTGCTCCTGTGTGTGTGTTGG - Intronic
1135866647 16:26109000-26109022 CTAGGTTACTCTGTGTCTCTAGG - Intronic
1137496783 16:48975580-48975602 CTGTGTTAGACTGTGAAGGTGGG - Intergenic
1138023418 16:53503918-53503940 CTTTGTAAATCTGTGTGTGTCGG + Intronic
1138969651 16:62129427-62129449 CTGTGTTATTCTGAGCAGGTTGG - Intergenic
1141223276 16:82091400-82091422 CTCTGTTTCTCTGTCTCTGTGGG - Intronic
1141777151 16:86131940-86131962 CTGTGTTCCTGTGTCTGTGTTGG + Intergenic
1143471006 17:7175424-7175446 TTGTGTGAATGTGTGTATGTGGG - Intronic
1143845633 17:9771198-9771220 CAGTGTGAGTGTGTGTATGTGGG + Intergenic
1144139925 17:12338211-12338233 GTGTGTTAATCTGTGCATCTGGG + Intergenic
1144426269 17:15145114-15145136 CATGGTTACTCTGTGTGTGTGGG - Intergenic
1144619215 17:16805759-16805781 CAGGGTGACTCTGAGTATGTGGG - Intergenic
1144893482 17:18509936-18509958 CAGGGTGACTCTGAGTATGTGGG + Intergenic
1145263917 17:21370453-21370475 CTTTTTTTCTCTGTGTGTGTTGG + Intergenic
1146498073 17:33340738-33340760 ATGTGTGTCTCTGTGTGTGTTGG + Intronic
1147311030 17:39596373-39596395 CTGTGTGTATGTGTGTATGTGGG + Intergenic
1148848841 17:50544485-50544507 CTGGGTGACTCTGAGAATGTGGG - Intronic
1149090846 17:52776628-52776650 CAGTGTTATTCTGTTTATTTAGG + Intergenic
1149546424 17:57507155-57507177 ATCTGTTTCTCTGTGTGTGTTGG + Intronic
1150443684 17:65211941-65211963 CTGTGTGGCTCTGTGGATCTTGG + Intronic
1151024293 17:70659162-70659184 CTGTGTAACTATGAGGATGTTGG + Intergenic
1152359912 17:79827702-79827724 GTGTGTTGCTGTGTGTGTGTGGG + Intergenic
1152481870 17:80559629-80559651 CTCTGTTTCTCTGTGTATGCTGG + Intronic
1152695796 17:81793963-81793985 CTGTGTGCATCTGTGCATGTCGG - Intergenic
1153084697 18:1271200-1271222 CCCTGTCACTCTCTGTATGTTGG + Intergenic
1153135161 18:1909333-1909355 ATGTATTATTCTGTGTACGTAGG - Intergenic
1154351908 18:13590310-13590332 GTGTGTTGGTATGTGTATGTGGG + Intronic
1154406648 18:14098051-14098073 GTCTGTTGCTCTGTGTATGAGGG - Intronic
1154437183 18:14355452-14355474 GTGTGTTTCTGTGTGTAGGTGGG + Intergenic
1154970152 18:21400167-21400189 CTGCTTTACTCTGTGTATTAAGG + Intronic
1155688489 18:28585433-28585455 CCCTGTTACTCTCTGTATATCGG - Intergenic
1155768899 18:29672414-29672436 CTGGGCTCCTCTGTGTATGGTGG - Intergenic
1155787686 18:29921598-29921620 CTGTGTAAGTCTGTCTATGATGG + Intergenic
1156104393 18:33640452-33640474 CTGGGTTACTATGTGTGTTTAGG + Intronic
1156457043 18:37300625-37300647 CTTTGTTCCTCTCTGTATCTTGG - Intronic
1157441071 18:47712111-47712133 ATGTGATACTTTGTGTTTGTGGG - Intergenic
1159674434 18:71264308-71264330 TTGTGTTACTATGTGTAAGCTGG + Intergenic
1160033267 18:75280612-75280634 CTGTGTTACTTTGGGGAAGTCGG + Intronic
1160139049 18:76302993-76303015 CTGTTTTACTCTCTGTCTCTTGG - Intergenic
1161282247 19:3452401-3452423 CCGTGTGACTGTGTGTCTGTGGG - Intronic
1163085746 19:14978895-14978917 GTGTGTTTCTGTGTGTAGGTAGG - Intronic
1166026089 19:40086223-40086245 CTATGTTTTTCTATGTATGTTGG + Intronic
1166963603 19:46514677-46514699 CTGTGTAAGTCTGTGTGTGTAGG - Intronic
1167650707 19:50727064-50727086 CTGTATTCCTCTGGGGATGTGGG - Intergenic
1168438517 19:56342765-56342787 CTCTGTATCTCCGTGTATGTGGG - Intronic
1168532371 19:57139927-57139949 CTGTGTGACCCTGTGTGAGTGGG - Intronic
925006269 2:445156-445178 CTGTCCTACTCTGTGTCTGTGGG + Intergenic
925084459 2:1097100-1097122 CTGTGTTAAAGTGTGTATATGGG - Intronic
926724340 2:15985562-15985584 CTGTGTGGCTCCGTGTGTGTCGG + Intergenic
927300833 2:21512264-21512286 CTTTCTTATTTTGTGTATGTTGG - Intergenic
927574755 2:24191799-24191821 CTCTGCTACTCTGTGTGTTTTGG - Intronic
928101182 2:28438247-28438269 CTGTGTGTCACTGTGTATCTGGG + Intergenic
928208891 2:29309038-29309060 CTCAGTTTCTCTGTGTATGATGG + Intronic
929642072 2:43591464-43591486 CTGTGATTCTCTGTGGAGGTGGG - Intronic
929690556 2:44068996-44069018 CTGGGCAACTCTGTGTCTGTTGG + Intergenic
929741395 2:44604608-44604630 CTATTTTACTATGTGTATTTAGG - Intronic
931070333 2:58640378-58640400 TTGTGTTAGTCTGGGTATTTTGG - Intergenic
932044010 2:68328974-68328996 CTCAGTTTCTCTGTGTCTGTTGG + Intergenic
932711851 2:74071363-74071385 CTGTGAAAATCTTTGTATGTGGG + Intronic
933228690 2:79780522-79780544 TTGTGTTTCTCTATGTTTGTGGG - Intronic
934581894 2:95448683-95448705 CTCTGTTTCTCTCTCTATGTTGG + Intergenic
934597556 2:95628031-95628053 CTCTGTTTCTCTCTCTATGTTGG - Intergenic
939673902 2:145047832-145047854 CTAAGTTACTCTGTTTCTGTGGG + Intergenic
940699297 2:157021963-157021985 CCATGTTGCTCTGTGTATATTGG - Intergenic
940750857 2:157625930-157625952 CTGAGTTGCTCTGGTTATGTAGG - Intronic
942430561 2:175906820-175906842 ATGTGTTTCTCTTTGTCTGTTGG + Intergenic
943043861 2:182834823-182834845 CTGTGTTACTTTTTGTATTTCGG + Exonic
943721189 2:191205070-191205092 ATGTGTTTCTGTGTGTGTGTTGG + Intergenic
943950450 2:194128209-194128231 ATGTGTGTGTCTGTGTATGTGGG + Intergenic
944145909 2:196507309-196507331 CTGTTTTTCTCTGTATATGTTGG - Intronic
944696946 2:202210152-202210174 TAATGTTACTCTGTGTATGAAGG + Intronic
945125332 2:206503274-206503296 CATAGTTACTCTCTGTATGTTGG + Intronic
945977271 2:216280704-216280726 CTGTGTCACCCTGGGCATGTTGG + Intronic
946041547 2:216786903-216786925 TTGGCTTACTCTGTGTCTGTGGG + Intergenic
946712278 2:222518489-222518511 CTGTGATATTTTGTTTATGTTGG + Intronic
946920350 2:224574534-224574556 CTGTGTTACCATTTGTATATGGG - Intronic
948559925 2:238846064-238846086 CTGTGTCACTCTGGCTCTGTCGG - Intergenic
948951980 2:241258978-241259000 CTGTTTTACCCAGTGTATCTTGG - Intronic
1168766252 20:383127-383149 CTGTGTGACTGTGTGTGTGGTGG - Intronic
1169277333 20:4242870-4242892 GTGTGTTTGTGTGTGTATGTAGG + Intronic
1169959973 20:11148832-11148854 CTGTGTGTCTGTGTGTCTGTGGG + Intergenic
1171144554 20:22770269-22770291 GTGTGTGAATCTGTGTCTGTTGG - Intergenic
1173469676 20:43313287-43313309 CTGTGTTCCACTGTGAGTGTAGG - Intergenic
1173603209 20:44310701-44310723 GTGTGTGTCTCTGTATATGTAGG - Intronic
1174850377 20:53988209-53988231 CTATGTGACTCTGAGTAAGTGGG - Intronic
1175549362 20:59806663-59806685 CTGCATAACTGTGTGTATGTGGG - Intronic
1175640325 20:60624183-60624205 CTCTGTTACTATTTGTATCTTGG + Intergenic
1175882169 20:62266420-62266442 CTGTCTGAGTCTGTCTATGTTGG - Intronic
1176839863 21:13830191-13830213 GTGTGTTTCTGTGTGTAGGTGGG - Intergenic
1177377196 21:20286315-20286337 CTGTGCTAGGCTGGGTATGTTGG - Intergenic
1178247882 21:30971629-30971651 GTGTGTTTGTGTGTGTATGTGGG + Intergenic
1179772435 21:43632220-43632242 GTGTGTGAGCCTGTGTATGTGGG - Intronic
1180338238 22:11598693-11598715 GTGTGTAACTGTGTGTGTGTCGG + Intergenic
1181601488 22:23954667-23954689 CAGTGTGAATTTGTGTATGTGGG - Intergenic
1181607020 22:23986674-23986696 CAGTGTGAATTTGTGTATGTGGG + Intergenic
1182786888 22:32915486-32915508 CTGTGTTATTCTGGGTAGGATGG + Intronic
1182817561 22:33179278-33179300 CTGTCTTCCTCTGTACATGTGGG - Intronic
1183614860 22:38937806-38937828 GTGTGTGAGTGTGTGTATGTGGG + Intergenic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
1184596836 22:45518988-45519010 CTGTGCCACTCTGTGATTGTCGG + Intronic
1184842242 22:47058791-47058813 CCGTGTTGCTCTGTGACTGTTGG + Intronic
1185140235 22:49096271-49096293 ATGTGTGCCTTTGTGTATGTGGG - Intergenic
949331120 3:2923493-2923515 CTGTGTTAATCTGTGTTCGTAGG - Intronic
950001610 3:9660836-9660858 CTTGGTTACTCTGTGTAGCTGGG + Intronic
951839183 3:27015419-27015441 CTGTGTTTCTCTGTGGAGTTAGG + Intergenic
952188721 3:30999186-30999208 CTGTCTTAGTCTGTGTTTCTAGG + Intergenic
952311509 3:32194715-32194737 GTGTGTGCCTCTGTGTGTGTGGG - Intergenic
953249881 3:41235500-41235522 CTCTGTTGCACTGTGTATGGGGG + Intronic
954366711 3:50150305-50150327 GTGTGTGTCTGTGTGTATGTTGG - Intergenic
955498112 3:59557519-59557541 CTGTGAAACTCTGCGTATGAGGG + Intergenic
957590024 3:82184851-82184873 GTGTGTTTGTGTGTGTATGTTGG + Intergenic
958748574 3:98166755-98166777 CTGTGCTACTGTATGTATTTCGG + Intergenic
959565084 3:107825812-107825834 CTGTGTCACTCTGTGCCTCTGGG - Intergenic
959577366 3:107948912-107948934 CTGTCTTAATATTTGTATGTTGG + Intergenic
961613826 3:128163182-128163204 CTCTGGTACTCTGGGTATCTTGG + Intronic
962749028 3:138419265-138419287 CTCCCTTACTCTGTGTATGGAGG - Intergenic
963868644 3:150389599-150389621 CTGTGTTAAGCAGTGAATGTGGG - Intergenic
964932658 3:162045804-162045826 CTGGATTATACTGTGTATGTGGG - Intergenic
965116677 3:164499399-164499421 CTGTGTGTCTGTGTGTATGTTGG + Intergenic
966671001 3:182525846-182525868 GTGTGGTATTCTGTGTACGTGGG - Intergenic
966749108 3:183305195-183305217 CCATTTTTCTCTGTGTATGTTGG - Intronic
967112553 3:186307048-186307070 CTGTGTAACCATGTTTATGTTGG + Intronic
968392748 4:206123-206145 GTGTGTGACTGTGTGTGTGTGGG + Intergenic
969339952 4:6534145-6534167 GTGTGTTGGTGTGTGTATGTTGG - Intronic
969357735 4:6640439-6640461 CTGTTTTACCCTGTGTTTGGAGG - Exonic
969581812 4:8069878-8069900 CTGTGTCCCTGTGTTTATGTTGG + Intronic
969865417 4:10073705-10073727 CTTTGTTCCTATGTGTATTTTGG - Intergenic
972858366 4:43136232-43136254 CTCTGTTACACTGTGTACCTTGG - Intergenic
972953924 4:44366079-44366101 ATGTGTTTCTCTGTTTTTGTTGG + Intronic
973594169 4:52468486-52468508 CTGTGTTGCTATGTTTATGAGGG + Intergenic
973641908 4:52911475-52911497 CTGTGCTACACTGGGAATGTTGG + Intronic
974571787 4:63660918-63660940 CTGTGTTTGTGTGTGTCTGTCGG + Intergenic
974715237 4:65660935-65660957 GTGTGTTACTCTTTGTTTGCTGG - Intronic
977208563 4:94191871-94191893 CAGTGGTACTATGTTTATGTAGG - Intergenic
977482004 4:97590616-97590638 CTGTGTGTCTGTGTGTATGTAGG - Intronic
978289433 4:107119553-107119575 CTGTGTTAGGCTCTGTGTGTAGG + Intronic
978642161 4:110883419-110883441 CTGTTTAACTCTCTGTATGAAGG + Intergenic
979028774 4:115611868-115611890 ATGTTTTAATCTGTGTGTGTTGG - Intergenic
979274239 4:118796998-118797020 CTGTGTTTCTGTGCGCATGTGGG + Intronic
979854430 4:125613381-125613403 CTGTGTGTGTATGTGTATGTGGG - Intergenic
980695319 4:136347997-136348019 GTGTGTTTGTGTGTGTATGTGGG - Intergenic
980981756 4:139660270-139660292 GTGTGTGACTTTGTGTGTGTGGG + Intergenic
981594282 4:146401671-146401693 CTGTGCTGCTCTGTGAATTTGGG - Intronic
983205197 4:164903708-164903730 CTATGTTACTATGTCTATTTCGG + Intergenic
983934371 4:173490761-173490783 CTGTATTACTCTTTGTATCTTGG - Intergenic
984132451 4:175895025-175895047 CTGTGTTACTTTGTGTTTCAGGG + Intronic
984244888 4:177263485-177263507 CTGTTTTACTCTGTATTTGAGGG - Intergenic
984903842 4:184609033-184609055 CTGGGTTTCTCTGTGTTGGTCGG + Intergenic
985010701 4:185579652-185579674 CTGTGTGTCTGTGTGTGTGTAGG + Intergenic
985174573 4:187187666-187187688 CTGGGTTTCTCTGTGTGTTTTGG + Intergenic
985220014 4:187694298-187694320 CTGTATCACTCTGTGAATGCTGG - Intergenic
986448649 5:7845408-7845430 CTTTTCTTCTCTGTGTATGTTGG - Intronic
986473645 5:8101214-8101236 CAGTGTTATTTTATGTATGTGGG - Intergenic
986799086 5:11241159-11241181 CTGTGTGTGTCTGTGTGTGTTGG - Intronic
987982834 5:25109902-25109924 CTGTGCACCTATGTGTATGTGGG - Intergenic
989105341 5:37857849-37857871 GTGTGTGTCTCTGTGTGTGTGGG + Intergenic
989173185 5:38493979-38494001 CTGTGTTAATCTATGTATACAGG - Intronic
989520448 5:42394784-42394806 CAGTGTTTCTCTGTGGATGGGGG - Intergenic
991393469 5:66176224-66176246 CTGTGTTTTTCTGTGTGTTTGGG + Intronic
993280656 5:85920954-85920976 CTGGGTTCCTCTGTGTATGGTGG - Intergenic
993440048 5:87945366-87945388 ATGTGTCACTGTGTGTAAGTTGG + Intergenic
994721828 5:103389523-103389545 GTGTGTTTCTGTGTGTGTGTGGG + Intergenic
995985555 5:118166947-118166969 CTGGCTTACTCTATCTATGTGGG - Intergenic
996020515 5:118586323-118586345 CTCTGTGTCTCTGTGTCTGTTGG - Intergenic
996710374 5:126537457-126537479 CGGTGTTTCTCTGTGAGTGTAGG + Intergenic
996851093 5:127953133-127953155 GTGTTTTAATCTGTGTATTTAGG - Intergenic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
998679996 5:144456462-144456484 CTGTGTGCGTCTGTGTGTGTTGG - Intronic
999078961 5:148825864-148825886 CTGGGTTACCGGGTGTATGTTGG + Exonic
999444382 5:151627842-151627864 CTGTGTTACTCACTGGCTGTGGG - Intergenic
1000186841 5:158866957-158866979 GTTTGTGCCTCTGTGTATGTTGG - Intronic
1000685128 5:164238956-164238978 CTGAGGAGCTCTGTGTATGTAGG - Intergenic
1000847652 5:166301438-166301460 CTCTGTTACTCTCTGTGTCTTGG - Intergenic
1001226444 5:169948507-169948529 ATGTGTTTCTATGTGTGTGTAGG - Intronic
1002026804 5:176401243-176401265 CACTGTTACTTTGTGTATATGGG + Intronic
1004271799 6:14202218-14202240 CTGTGTGTCTCTGCGTGTGTGGG - Intergenic
1004562854 6:16767399-16767421 CTGTGTTACACAGTGTAAGGGGG - Intergenic
1004863852 6:19835070-19835092 CTGAGTTACTCTGTGTGGGGTGG - Intergenic
1006251037 6:32785492-32785514 ATGTGTATCTTTGTGTATGTGGG - Intergenic
1006982420 6:38157216-38157238 CTGTGTTTCTGTGTGAATTTGGG - Intergenic
1007250449 6:40491462-40491484 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250476 6:40491654-40491676 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007328403 6:41081966-41081988 CTAGTCTACTCTGTGTATGTAGG + Intronic
1007627653 6:43255369-43255391 CTGTGGGACTCTGTGGGTGTTGG + Intronic
1007698929 6:43754127-43754149 ATATGTGAGTCTGTGTATGTGGG + Intergenic
1007724977 6:43910363-43910385 CTGTGTTAATATATGTTTGTGGG - Intergenic
1008589983 6:52984425-52984447 TTTGGTTGCTCTGTGTATGTAGG + Intronic
1012506404 6:99951437-99951459 CTCTGTCACTCTATGTATCTAGG - Intronic
1014419702 6:121227918-121227940 CTGTTTTTCTCTGTGTAAGGAGG + Intronic
1016067675 6:139700661-139700683 ATGTGTGCATCTGTGTATGTTGG - Intergenic
1017280506 6:152619323-152619345 CTGTGTGACCCTGTTTATGTTGG - Intronic
1017848903 6:158285579-158285601 CTGAGATTCTCTCTGTATGTTGG + Intronic
1018565597 6:165147863-165147885 GTGTGTTTCTCTGAATATGTTGG - Intergenic
1019305805 7:334422-334444 GTGTGTTTCTGTGTGCATGTGGG - Intergenic
1019305811 7:334686-334708 GTGTGTTTCTGTGTGCATGTGGG - Intergenic
1019305822 7:335004-335026 GTGTGTTTCTGTGTGCATGTGGG - Intergenic
1020116020 7:5476827-5476849 CTGGGTTCCTCAGTGTCTGTGGG + Intronic
1020840302 7:13209404-13209426 ATATATTACTATGTGTATGTTGG + Intergenic
1020929792 7:14378314-14378336 CTTTTTGACTCTGTTTATGTGGG - Intronic
1021507047 7:21397422-21397444 CTCTATTTCTCTTTGTATGTTGG + Intergenic
1022421123 7:30224425-30224447 CTATCTTACTCAGTGAATGTAGG + Intergenic
1024755302 7:52522327-52522349 CTGTGTTATTCTGTCTATAATGG - Intergenic
1025231911 7:57208147-57208169 GGGTTTTACTCTGAGTATGTGGG + Intergenic
1026396533 7:69960518-69960540 CTGTGTAATTCTGTGTATAAAGG + Intronic
1026603980 7:71800283-71800305 CTGTGTGACCCTGGGAATGTTGG - Intronic
1026805606 7:73427903-73427925 GTGTGTGTCTCTGTGTGTGTAGG - Intergenic
1027544817 7:79514064-79514086 CTGTGCAACTGTGTGGATGTGGG + Intergenic
1028015841 7:85711079-85711101 CTCTGTCACTCTTTGAATGTTGG - Intergenic
1030336423 7:108332365-108332387 CTGGGTTACTTTCTGTATCTGGG + Intronic
1030658032 7:112190008-112190030 TTGTTTTCCTCTGTGGATGTCGG + Intronic
1030736725 7:113057654-113057676 CTGTGTCTTTCTCTGTATGTAGG + Intergenic
1031269315 7:119626027-119626049 CTGTATTAATCTGTGTTTCTTGG - Intergenic
1032086745 7:128887956-128887978 GTGTGTGCATCTGTGTATGTGGG - Intronic
1032507203 7:132444658-132444680 CTGTGTTAAGGTGTGTGTGTTGG + Intronic
1037242264 8:16790845-16790867 TTGTGACACTCTTTGTATGTTGG - Intergenic
1038627092 8:29204634-29204656 GTGTATTACCCTGTGAATGTGGG - Intronic
1038951845 8:32423720-32423742 GTGTGTGTCTGTGTGTATGTGGG - Intronic
1039291534 8:36099863-36099885 CTATGTTACTTTGTGTATGAAGG - Intergenic
1039552367 8:38452178-38452200 CTGTGTGTCTGTGTGTCTGTCGG - Intronic
1041313596 8:56540096-56540118 CTCTCTGCCTCTGTGTATGTTGG - Intergenic
1042994020 8:74673563-74673585 TTGTGTTACACTTTGTATCTAGG + Intronic
1043881324 8:85546636-85546658 TTTTTTTATTCTGTGTATGTTGG - Intergenic
1045369958 8:101513460-101513482 GTATGTGTCTCTGTGTATGTGGG + Intronic
1046167564 8:110457248-110457270 GTGTGTTCCTGTGTGTGTGTTGG - Intergenic
1046459872 8:114519475-114519497 GTGTGTGTCTCTGTGTGTGTTGG + Intergenic
1046867426 8:119166115-119166137 CAGTGTCACTTTTTGTATGTAGG - Intronic
1048499292 8:134961087-134961109 ATGTGTTACTCTTTCTAAGTAGG + Intergenic
1048925344 8:139266317-139266339 CTGAGCTACTCTGTGCATGCAGG + Intergenic
1051967547 9:22846930-22846952 CATAGTTACTCTGTGTGTGTGGG - Intergenic
1055462753 9:76534516-76534538 CTGGTTTACCCTGTGGATGTTGG + Intergenic
1056936768 9:90920928-90920950 CTGTGTATCTGTGTGTATCTGGG + Intergenic
1056938571 9:90936612-90936634 CTGTGTTGCTCTGTGGTTCTTGG - Intergenic
1056991649 9:91418353-91418375 CTGGGTTACTTTGTGATTGTTGG - Intronic
1057266035 9:93618790-93618812 CTGTGTATTTCTGTGTATGAGGG + Intronic
1057728997 9:97592705-97592727 CTGTGGTTATCTGTGCATGTGGG - Intronic
1059715056 9:116905814-116905836 CTGTGCTTCCCTGTGTATCTGGG - Intronic
1059757992 9:117311698-117311720 GTGTGTATCTCTGTGTGTGTGGG - Intronic
1060346895 9:122824946-122824968 CTGAATTTCTCTGTTTATGTTGG - Intronic
1060488996 9:124068192-124068214 CTGGGTTACTCTTTGTCTGATGG + Intergenic
1060892434 9:127197378-127197400 CTGTGTGTCTGTGTGTCTGTCGG + Intronic
1061887561 9:133600199-133600221 CTGTGTGAGTGTGTGTGTGTGGG + Intergenic
1185480134 X:439597-439619 CTGTGTGCCTGTGTGTGTGTGGG - Intergenic
1185487286 X:491879-491901 CTGTGTGCATCTGTGCATGTGGG - Intergenic
1185487322 X:492307-492329 CTGTGTGCATCTGTGCATGTGGG - Intergenic
1185927096 X:4159375-4159397 GTGTGTATGTCTGTGTATGTTGG + Intergenic
1187478580 X:19634130-19634152 CTGTGTCTCTCTGTGTCTCTCGG - Intronic
1190239466 X:48646186-48646208 CTCTGTTTCTCTGTGTTTATAGG - Intergenic
1190785478 X:53643795-53643817 ATTTGTTACTATTTGTATGTAGG - Intronic
1191662405 X:63665252-63665274 CTGGATAACTCTGTGTATGTTGG - Intronic
1194918785 X:99737639-99737661 CAATGTTACCCTGTGAATGTAGG - Intergenic
1195212145 X:102660399-102660421 CTGTGTTTCTATGTGTGGGTGGG + Intergenic
1195239407 X:102936199-102936221 CTGTGTGTGTCTGTGTATGGGGG - Intergenic
1195298300 X:103501862-103501884 CTGTGTGTGTCTGTGTATGGGGG + Exonic
1195371217 X:104175678-104175700 CTGTTTTCATCTGTGTCTGTTGG + Exonic
1196363459 X:114895570-114895592 CTGTTTTCTTCTTTGTATGTAGG + Intronic
1196622023 X:117834890-117834912 ATATGTTACTTTGTGTATCTTGG + Intergenic
1198328382 X:135596753-135596775 CTGTGTTCCTCCGCCTATGTCGG - Intergenic