ID: 912597064

View in Genome Browser
Species Human (GRCh38)
Location 1:110889675-110889697
Sequence AACACTTATCCCTTATAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912597064_912597071 10 Left 912597064 1:110889675-110889697 CCACCCTATAAGGGATAAGTGTT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 912597071 1:110889708-110889730 ACATAGGAAGAAATTGTGACTGG No data
912597064_912597068 -6 Left 912597064 1:110889675-110889697 CCACCCTATAAGGGATAAGTGTT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 912597068 1:110889692-110889714 AGTGTTGGCCCGTTTTACATAGG 0: 1
1: 0
2: 0
3: 6
4: 46
912597064_912597072 24 Left 912597064 1:110889675-110889697 CCACCCTATAAGGGATAAGTGTT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 912597072 1:110889722-110889744 TGTGACTGGAACTGTTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912597064 Original CRISPR AACACTTATCCCTTATAGGG TGG (reversed) Intronic
902110585 1:14074911-14074933 AACACATTTCACTTAGAGGGTGG - Intergenic
904703617 1:32374312-32374334 AACAATTATCCCGTTTATGGAGG + Intronic
910522488 1:88138416-88138438 CACAATTATCCCTTAAAGGTAGG + Intergenic
910612626 1:89161383-89161405 AACACTTATCCATTGTTGGTGGG - Intronic
912597064 1:110889675-110889697 AACACTTATCCCTTATAGGGTGG - Intronic
916265536 1:162886862-162886884 AACAGTCATCCCTGACAGGGTGG - Intergenic
923601608 1:235408162-235408184 AACACTTATCCTTTATTGCTAGG - Intronic
1063520338 10:6735462-6735484 AATACTTATACCTTATTGGTGGG - Intergenic
1068946803 10:62737803-62737825 AATAATTCTCCCTCATAGGGTGG - Intergenic
1071315014 10:84387236-84387258 AACAGTTAACCCTTAGAGGGAGG - Intronic
1080399305 11:31919521-31919543 AACACTTGGCCTTTTTAGGGGGG - Intronic
1088662025 11:112056784-112056806 AACACTTATCCACTATTGGTGGG - Intronic
1095894849 12:47269849-47269871 AACCCTTATCCCTCTTAGTGCGG - Intergenic
1105984910 13:25556224-25556246 AACACTTATCCACTATTGGTGGG - Intronic
1114437283 14:22716916-22716938 AACACTAATTCCTTAGAAGGAGG - Intergenic
1114984022 14:28203362-28203384 AACACTAATTCCTTAGAAGGAGG + Intergenic
1116337880 14:43681234-43681256 AACACTAATCCGTTATTGAGTGG - Intergenic
1139511038 16:67428744-67428766 ACCCCTTATCCCTTATTAGGTGG - Intergenic
1148994204 17:51694265-51694287 AACACTTATACATTATTGGTGGG - Intronic
1150298544 17:64029013-64029035 AACACTTAACCTTTACAAGGTGG - Intergenic
1150948355 17:69773329-69773351 AACACTTATACCTTGTTGGTGGG + Intergenic
1157287317 18:46385814-46385836 AACACTTATCACTTACAGAGGGG - Intronic
1166416927 19:42601969-42601991 AACACTGATCCCTGGCAGGGAGG + Intronic
927273530 2:21240214-21240236 AACACTTATACATTATTGGTGGG - Intergenic
929164754 2:38870480-38870502 ACAACTTATCACTTACAGGGGGG + Intronic
930459748 2:51657740-51657762 AACCCTTATCCCTAATGTGGTGG + Intergenic
942801446 2:179881006-179881028 AACACTTATCCCTCAGAAAGTGG - Intergenic
944252946 2:197595852-197595874 AGCACATTTCCCTTATAGGTTGG + Intronic
944731618 2:202523261-202523283 AACACTTATACATTATTGGTGGG + Intronic
945016159 2:205519204-205519226 ATCAGTTATCCCTGAAAGGGAGG - Intronic
1170003805 20:11644922-11644944 GACACTAATCCCTTATATGAGGG - Intergenic
1174633237 20:51976792-51976814 ATCACTTCTCCCTTATCAGGTGG - Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177929469 21:27263010-27263032 GACTCTTTTCCCTTTTAGGGAGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
949219820 3:1618375-1618397 AACAATTATCCCTTTTTTGGAGG - Intergenic
950706640 3:14786601-14786623 AACACTCATCCATTATTGGAGGG + Intergenic
957546805 3:81649359-81649381 AACACTTGTCACTAATATGGCGG + Intronic
958983376 3:100751831-100751853 ATCACTAATCCCTGAAAGGGAGG - Intronic
964677823 3:159303395-159303417 AGCCCTTTTCCCTAATAGGGGGG + Intronic
969503412 4:7569009-7569031 AACACAGATCCCTGATAGGATGG - Intronic
972517866 4:39826202-39826224 AACGCATTTCCCTAATAGGGAGG + Intronic
977052863 4:92151727-92151749 AACACTTATACATTATTGGTGGG + Intergenic
977108076 4:92915677-92915699 AACACTTATACATTGTAGGTGGG - Intronic
977374921 4:96190284-96190306 AACACTTATACATTGTTGGGGGG - Intergenic
979833968 4:125338331-125338353 AACACTTATCCCTTCTAATTCGG - Intronic
981028639 4:140101300-140101322 AACACTTTTCCTCTAAAGGGAGG + Intronic
986476087 5:8134883-8134905 CACACTTGTCCCTTGTAGGCTGG + Intergenic
996704127 5:126479539-126479561 AACAGTTATCCATTACAGGGTGG - Intronic
999357936 5:150954589-150954611 AAAACATATCCCTTATAGAATGG + Intergenic
1010596646 6:77771319-77771341 AACACTTATACATTGTTGGGGGG + Intronic
1010738587 6:79471348-79471370 AACACTTAACACTTATCAGGGGG - Intergenic
1017875473 6:158520848-158520870 AACACTTTGCCCTTATAGTGAGG - Intergenic
1020995976 7:15264812-15264834 AACACTTATACCTTGTTGGTGGG + Intronic
1022990581 7:35703243-35703265 AAGAATTATCACTTATAGGCTGG - Intergenic
1031055652 7:116990408-116990430 AACACTAACCCCTTAGAGGAAGG - Intronic
1031113618 7:117642420-117642442 ATCACTTTTACCTTATAGGTGGG + Exonic
1047945507 8:129874337-129874359 CACACTAATTTCTTATAGGGTGG + Intronic
1051298460 9:15621660-15621682 AACACTTATGCATTATTGGCAGG + Intronic
1053528955 9:38859259-38859281 ATCACTTATTCATTATAAGGAGG - Intergenic
1054201183 9:62083694-62083716 ATCACTTATTCATTATAAGGAGG - Intergenic
1054637176 9:67504670-67504692 ATCACTTATTCATTATAAGGAGG + Intergenic
1057936572 9:99244518-99244540 ACCACTTCTGCCTTATAAGGAGG - Intergenic
1188732247 X:33664097-33664119 AACACTTATACATTATTGGTGGG + Intergenic
1199268345 X:145854089-145854111 GACATTTATCCATAATAGGGGGG + Intergenic