ID: 912598627

View in Genome Browser
Species Human (GRCh38)
Location 1:110904206-110904228
Sequence CACTCTGAAGAGAAGGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912598622_912598627 2 Left 912598622 1:110904181-110904203 CCACCCAGGGTCTAGAGGGACTT No data
Right 912598627 1:110904206-110904228 CACTCTGAAGAGAAGGACGCAGG No data
912598615_912598627 22 Left 912598615 1:110904161-110904183 CCCAGACAGCACCTCTGGAACCA No data
Right 912598627 1:110904206-110904228 CACTCTGAAGAGAAGGACGCAGG No data
912598619_912598627 11 Left 912598619 1:110904172-110904194 CCTCTGGAACCACCCAGGGTCTA No data
Right 912598627 1:110904206-110904228 CACTCTGAAGAGAAGGACGCAGG No data
912598625_912598627 -2 Left 912598625 1:110904185-110904207 CCAGGGTCTAGAGGGACTTGGCA No data
Right 912598627 1:110904206-110904228 CACTCTGAAGAGAAGGACGCAGG No data
912598616_912598627 21 Left 912598616 1:110904162-110904184 CCAGACAGCACCTCTGGAACCAC No data
Right 912598627 1:110904206-110904228 CACTCTGAAGAGAAGGACGCAGG No data
912598624_912598627 -1 Left 912598624 1:110904184-110904206 CCCAGGGTCTAGAGGGACTTGGC No data
Right 912598627 1:110904206-110904228 CACTCTGAAGAGAAGGACGCAGG No data
912598612_912598627 30 Left 912598612 1:110904153-110904175 CCCTGACTCCCAGACAGCACCTC No data
Right 912598627 1:110904206-110904228 CACTCTGAAGAGAAGGACGCAGG No data
912598613_912598627 29 Left 912598613 1:110904154-110904176 CCTGACTCCCAGACAGCACCTCT No data
Right 912598627 1:110904206-110904228 CACTCTGAAGAGAAGGACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912598627 Original CRISPR CACTCTGAAGAGAAGGACGC AGG Intergenic
No off target data available for this crispr